ID: 1025230708

View in Genome Browser
Species Human (GRCh38)
Location 7:57201777-57201799
Sequence CTGGCCAATGTCGTTGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025230700_1025230708 13 Left 1025230700 7:57201741-57201763 CCACATCTGGCCGAAAAAAGGCT No data
Right 1025230708 7:57201777-57201799 CTGGCCAATGTCGTTGAAGGTGG No data
1025230702_1025230708 3 Left 1025230702 7:57201751-57201773 CCGAAAAAAGGCTGCGGCCACCA No data
Right 1025230708 7:57201777-57201799 CTGGCCAATGTCGTTGAAGGTGG No data
1025230698_1025230708 23 Left 1025230698 7:57201731-57201753 CCTGTTCGTACCACATCTGGCCG No data
Right 1025230708 7:57201777-57201799 CTGGCCAATGTCGTTGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025230708 Original CRISPR CTGGCCAATGTCGTTGAAGG TGG Intergenic
No off target data available for this crispr