ID: 1025231009

View in Genome Browser
Species Human (GRCh38)
Location 7:57203343-57203365
Sequence GCGCACGGAAGCCCGGCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025231009_1025231021 18 Left 1025231009 7:57203343-57203365 CCCTCCGCCGGGCTTCCGTGCGC No data
Right 1025231021 7:57203384-57203406 GCACGCACCTCTCGCAGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025231009 Original CRISPR GCGCACGGAAGCCCGGCGGA GGG (reversed) Intergenic
No off target data available for this crispr