ID: 1025233427

View in Genome Browser
Species Human (GRCh38)
Location 7:57218076-57218098
Sequence GTGTGTCAGTTGAAGTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025233422_1025233427 9 Left 1025233422 7:57218044-57218066 CCGTGCTGCTGTTTAACTGTGGG No data
Right 1025233427 7:57218076-57218098 GTGTGTCAGTTGAAGTTTGATGG No data
1025233420_1025233427 10 Left 1025233420 7:57218043-57218065 CCCGTGCTGCTGTTTAACTGTGG No data
Right 1025233427 7:57218076-57218098 GTGTGTCAGTTGAAGTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025233427 Original CRISPR GTGTGTCAGTTGAAGTTTGA TGG Intergenic
No off target data available for this crispr