ID: 1025233583

View in Genome Browser
Species Human (GRCh38)
Location 7:57218954-57218976
Sequence GTGTGTCAGTTGAAGTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025233580_1025233583 -8 Left 1025233580 7:57218939-57218961 CCTTGGAGGGATCCGGTGTGTCA No data
Right 1025233583 7:57218954-57218976 GTGTGTCAGTTGAAGTTTGAGGG No data
1025233576_1025233583 8 Left 1025233576 7:57218923-57218945 CCATGCTGCTGTTTAACCTTGGA No data
Right 1025233583 7:57218954-57218976 GTGTGTCAGTTGAAGTTTGAGGG No data
1025233574_1025233583 9 Left 1025233574 7:57218922-57218944 CCCATGCTGCTGTTTAACCTTGG No data
Right 1025233583 7:57218954-57218976 GTGTGTCAGTTGAAGTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025233583 Original CRISPR GTGTGTCAGTTGAAGTTTGA GGG Intergenic
No off target data available for this crispr