ID: 1025236455

View in Genome Browser
Species Human (GRCh38)
Location 7:57237922-57237944
Sequence TTGCAAGAAGAGTGAGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025236455_1025236461 -1 Left 1025236455 7:57237922-57237944 CCATTCTCTCACTCTTCTTGCAA No data
Right 1025236461 7:57237944-57237966 AGTCAGCAGGGCAGAGGCAGGGG No data
1025236455_1025236462 17 Left 1025236455 7:57237922-57237944 CCATTCTCTCACTCTTCTTGCAA No data
Right 1025236462 7:57237962-57237984 AGGGGCAGCAGAGCCCCACTTGG No data
1025236455_1025236458 -7 Left 1025236455 7:57237922-57237944 CCATTCTCTCACTCTTCTTGCAA No data
Right 1025236458 7:57237938-57237960 CTTGCAAGTCAGCAGGGCAGAGG No data
1025236455_1025236460 -2 Left 1025236455 7:57237922-57237944 CCATTCTCTCACTCTTCTTGCAA No data
Right 1025236460 7:57237943-57237965 AAGTCAGCAGGGCAGAGGCAGGG No data
1025236455_1025236459 -3 Left 1025236455 7:57237922-57237944 CCATTCTCTCACTCTTCTTGCAA No data
Right 1025236459 7:57237942-57237964 CAAGTCAGCAGGGCAGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025236455 Original CRISPR TTGCAAGAAGAGTGAGAGAA TGG (reversed) Intergenic
No off target data available for this crispr