ID: 1025236458

View in Genome Browser
Species Human (GRCh38)
Location 7:57237938-57237960
Sequence CTTGCAAGTCAGCAGGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025236455_1025236458 -7 Left 1025236455 7:57237922-57237944 CCATTCTCTCACTCTTCTTGCAA No data
Right 1025236458 7:57237938-57237960 CTTGCAAGTCAGCAGGGCAGAGG No data
1025236452_1025236458 27 Left 1025236452 7:57237888-57237910 CCTGATGGAAGTTTCTGGAAGCC No data
Right 1025236458 7:57237938-57237960 CTTGCAAGTCAGCAGGGCAGAGG No data
1025236453_1025236458 6 Left 1025236453 7:57237909-57237931 CCTTCGTCCAATTCCATTCTCTC No data
Right 1025236458 7:57237938-57237960 CTTGCAAGTCAGCAGGGCAGAGG No data
1025236454_1025236458 -1 Left 1025236454 7:57237916-57237938 CCAATTCCATTCTCTCACTCTTC No data
Right 1025236458 7:57237938-57237960 CTTGCAAGTCAGCAGGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025236458 Original CRISPR CTTGCAAGTCAGCAGGGCAG AGG Intergenic
No off target data available for this crispr