ID: 1025236461

View in Genome Browser
Species Human (GRCh38)
Location 7:57237944-57237966
Sequence AGTCAGCAGGGCAGAGGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025236455_1025236461 -1 Left 1025236455 7:57237922-57237944 CCATTCTCTCACTCTTCTTGCAA No data
Right 1025236461 7:57237944-57237966 AGTCAGCAGGGCAGAGGCAGGGG No data
1025236453_1025236461 12 Left 1025236453 7:57237909-57237931 CCTTCGTCCAATTCCATTCTCTC No data
Right 1025236461 7:57237944-57237966 AGTCAGCAGGGCAGAGGCAGGGG No data
1025236454_1025236461 5 Left 1025236454 7:57237916-57237938 CCAATTCCATTCTCTCACTCTTC No data
Right 1025236461 7:57237944-57237966 AGTCAGCAGGGCAGAGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025236461 Original CRISPR AGTCAGCAGGGCAGAGGCAG GGG Intergenic
No off target data available for this crispr