ID: 1025242125

View in Genome Browser
Species Human (GRCh38)
Location 7:57285843-57285865
Sequence CCTTCCAGTCCAAATCCTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025242122_1025242125 5 Left 1025242122 7:57285815-57285837 CCTGGCTTCATCAGTGGAATTTT No data
Right 1025242125 7:57285843-57285865 CCTTCCAGTCCAAATCCTTCCGG No data
1025242119_1025242125 28 Left 1025242119 7:57285792-57285814 CCATGTGATCAATGGACATTTTT No data
Right 1025242125 7:57285843-57285865 CCTTCCAGTCCAAATCCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025242125 Original CRISPR CCTTCCAGTCCAAATCCTTC CGG Intergenic
No off target data available for this crispr