ID: 1025249939

View in Genome Browser
Species Human (GRCh38)
Location 7:57344804-57344826
Sequence GGGCCTGGTGTGAGACTTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025249931_1025249939 12 Left 1025249931 7:57344769-57344791 CCACAGGCCCAGTGGGTTACACT No data
Right 1025249939 7:57344804-57344826 GGGCCTGGTGTGAGACTTCGGGG No data
1025249933_1025249939 4 Left 1025249933 7:57344777-57344799 CCAGTGGGTTACACTAACAAATG No data
Right 1025249939 7:57344804-57344826 GGGCCTGGTGTGAGACTTCGGGG No data
1025249932_1025249939 5 Left 1025249932 7:57344776-57344798 CCCAGTGGGTTACACTAACAAAT No data
Right 1025249939 7:57344804-57344826 GGGCCTGGTGTGAGACTTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025249939 Original CRISPR GGGCCTGGTGTGAGACTTCG GGG Intergenic
No off target data available for this crispr