ID: 1025251963

View in Genome Browser
Species Human (GRCh38)
Location 7:57357445-57357467
Sequence TGCCCAGTGCCTGGCACTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025251963_1025251971 -6 Left 1025251963 7:57357445-57357467 CCACTAGTGCCAGGCACTGGGCA No data
Right 1025251971 7:57357462-57357484 TGGGCAAGGCTCTGGGGACGGGG No data
1025251963_1025251969 -8 Left 1025251963 7:57357445-57357467 CCACTAGTGCCAGGCACTGGGCA No data
Right 1025251969 7:57357460-57357482 ACTGGGCAAGGCTCTGGGGACGG No data
1025251963_1025251970 -7 Left 1025251963 7:57357445-57357467 CCACTAGTGCCAGGCACTGGGCA No data
Right 1025251970 7:57357461-57357483 CTGGGCAAGGCTCTGGGGACGGG No data
1025251963_1025251972 15 Left 1025251963 7:57357445-57357467 CCACTAGTGCCAGGCACTGGGCA No data
Right 1025251972 7:57357483-57357505 GGTGAAGTTCCCGCTTTCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025251963 Original CRISPR TGCCCAGTGCCTGGCACTAG TGG (reversed) Intergenic
No off target data available for this crispr