ID: 1025251965

View in Genome Browser
Species Human (GRCh38)
Location 7:57357454-57357476
Sequence CCAGAGCCTTGCCCAGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025251965_1025251975 23 Left 1025251965 7:57357454-57357476 CCAGGCACTGGGCAAGGCTCTGG No data
Right 1025251975 7:57357500-57357522 CGTAGGTCTGAAGCTCTAGCAGG No data
1025251965_1025251976 24 Left 1025251965 7:57357454-57357476 CCAGGCACTGGGCAAGGCTCTGG No data
Right 1025251976 7:57357501-57357523 GTAGGTCTGAAGCTCTAGCAGGG No data
1025251965_1025251972 6 Left 1025251965 7:57357454-57357476 CCAGGCACTGGGCAAGGCTCTGG No data
Right 1025251972 7:57357483-57357505 GGTGAAGTTCCCGCTTTCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025251965 Original CRISPR CCAGAGCCTTGCCCAGTGCC TGG (reversed) Intergenic
No off target data available for this crispr