ID: 1025251972

View in Genome Browser
Species Human (GRCh38)
Location 7:57357483-57357505
Sequence GGTGAAGTTCCCGCTTTCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025251963_1025251972 15 Left 1025251963 7:57357445-57357467 CCACTAGTGCCAGGCACTGGGCA No data
Right 1025251972 7:57357483-57357505 GGTGAAGTTCCCGCTTTCGTAGG No data
1025251965_1025251972 6 Left 1025251965 7:57357454-57357476 CCAGGCACTGGGCAAGGCTCTGG No data
Right 1025251972 7:57357483-57357505 GGTGAAGTTCCCGCTTTCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025251972 Original CRISPR GGTGAAGTTCCCGCTTTCGT AGG Intergenic
No off target data available for this crispr