ID: 1025253961

View in Genome Browser
Species Human (GRCh38)
Location 7:57370527-57370549
Sequence AATGCCAAGGGGAAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025253961_1025253970 -4 Left 1025253961 7:57370527-57370549 CCATCCACCTTCCCCTTGGCATT No data
Right 1025253970 7:57370546-57370568 CATTTTTGCCTGGGTCAAGAGGG No data
1025253961_1025253969 -5 Left 1025253961 7:57370527-57370549 CCATCCACCTTCCCCTTGGCATT No data
Right 1025253969 7:57370545-57370567 GCATTTTTGCCTGGGTCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025253961 Original CRISPR AATGCCAAGGGGAAGGTGGA TGG (reversed) Intergenic
No off target data available for this crispr