ID: 1025255424

View in Genome Browser
Species Human (GRCh38)
Location 7:57381362-57381384
Sequence CCTTCCCAGGAGAAGTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025255410_1025255424 10 Left 1025255410 7:57381329-57381351 CCTTGGCCTCACGAAAGACCAAG No data
Right 1025255424 7:57381362-57381384 CCTTCCCAGGAGAAGTGGGGTGG No data
1025255409_1025255424 16 Left 1025255409 7:57381323-57381345 CCAACACCTTGGCCTCACGAAAG No data
Right 1025255424 7:57381362-57381384 CCTTCCCAGGAGAAGTGGGGTGG No data
1025255404_1025255424 30 Left 1025255404 7:57381309-57381331 CCTCACTCCTATCCCCAACACCT No data
Right 1025255424 7:57381362-57381384 CCTTCCCAGGAGAAGTGGGGTGG No data
1025255406_1025255424 23 Left 1025255406 7:57381316-57381338 CCTATCCCCAACACCTTGGCCTC No data
Right 1025255424 7:57381362-57381384 CCTTCCCAGGAGAAGTGGGGTGG No data
1025255408_1025255424 17 Left 1025255408 7:57381322-57381344 CCCAACACCTTGGCCTCACGAAA No data
Right 1025255424 7:57381362-57381384 CCTTCCCAGGAGAAGTGGGGTGG No data
1025255413_1025255424 4 Left 1025255413 7:57381335-57381357 CCTCACGAAAGACCAAGGGACCC No data
Right 1025255424 7:57381362-57381384 CCTTCCCAGGAGAAGTGGGGTGG No data
1025255416_1025255424 -8 Left 1025255416 7:57381347-57381369 CCAAGGGACCCAGGGCCTTCCCA No data
Right 1025255424 7:57381362-57381384 CCTTCCCAGGAGAAGTGGGGTGG No data
1025255407_1025255424 18 Left 1025255407 7:57381321-57381343 CCCCAACACCTTGGCCTCACGAA No data
Right 1025255424 7:57381362-57381384 CCTTCCCAGGAGAAGTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025255424 Original CRISPR CCTTCCCAGGAGAAGTGGGG TGG Intergenic
No off target data available for this crispr