ID: 1025256316

View in Genome Browser
Species Human (GRCh38)
Location 7:57385849-57385871
Sequence TGTGACCTGGAGCAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025256316_1025256321 3 Left 1025256316 7:57385849-57385871 CCCTCCACCTGCTCCAGGTCACA No data
Right 1025256321 7:57385875-57385897 CAACTGCCTCCTCCTCCTAGCGG No data
1025256316_1025256326 25 Left 1025256316 7:57385849-57385871 CCCTCCACCTGCTCCAGGTCACA No data
Right 1025256326 7:57385897-57385919 GCTTCTCGAGCTCTCCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025256316 Original CRISPR TGTGACCTGGAGCAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr