ID: 1025258666

View in Genome Browser
Species Human (GRCh38)
Location 7:57402687-57402709
Sequence TGTTGGGTATAAAAATTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025258666_1025258677 22 Left 1025258666 7:57402687-57402709 CCCCCCAATTTTTATACCCAACA No data
Right 1025258677 7:57402732-57402754 ATACAAATAAATCCATACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025258666 Original CRISPR TGTTGGGTATAAAAATTGGG GGG (reversed) Intergenic
No off target data available for this crispr