ID: 1025261613

View in Genome Browser
Species Human (GRCh38)
Location 7:57424077-57424099
Sequence ATGTATATAAAAATGAATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025261610_1025261613 11 Left 1025261610 7:57424043-57424065 CCTTCATTTAGTTTTCATCACCC No data
Right 1025261613 7:57424077-57424099 ATGTATATAAAAATGAATCATGG No data
1025261612_1025261613 -10 Left 1025261612 7:57424064-57424086 CCAGAACTGTGACATGTATATAA No data
Right 1025261613 7:57424077-57424099 ATGTATATAAAAATGAATCATGG No data
1025261611_1025261613 -9 Left 1025261611 7:57424063-57424085 CCCAGAACTGTGACATGTATATA No data
Right 1025261613 7:57424077-57424099 ATGTATATAAAAATGAATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025261613 Original CRISPR ATGTATATAAAAATGAATCA TGG Intergenic
No off target data available for this crispr