ID: 1025261947

View in Genome Browser
Species Human (GRCh38)
Location 7:57425727-57425749
Sequence GACAGAGTGCTCGCTCCGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025261947_1025261960 27 Left 1025261947 7:57425727-57425749 CCCTTCGGAGCGAGCACTCTGTC No data
Right 1025261960 7:57425777-57425799 CCGGCAGGCCCAGGCAGTCCCGG No data
1025261947_1025261955 12 Left 1025261947 7:57425727-57425749 CCCTTCGGAGCGAGCACTCTGTC No data
Right 1025261955 7:57425762-57425784 TCTGGCTGGAGATCCCCGGCAGG No data
1025261947_1025261954 8 Left 1025261947 7:57425727-57425749 CCCTTCGGAGCGAGCACTCTGTC No data
Right 1025261954 7:57425758-57425780 CCTCTCTGGCTGGAGATCCCCGG No data
1025261947_1025261950 -2 Left 1025261947 7:57425727-57425749 CCCTTCGGAGCGAGCACTCTGTC No data
Right 1025261950 7:57425748-57425770 TCGCACCCAACCTCTCTGGCTGG No data
1025261947_1025261949 -6 Left 1025261947 7:57425727-57425749 CCCTTCGGAGCGAGCACTCTGTC No data
Right 1025261949 7:57425744-57425766 TCTGTCGCACCCAACCTCTCTGG No data
1025261947_1025261956 18 Left 1025261947 7:57425727-57425749 CCCTTCGGAGCGAGCACTCTGTC No data
Right 1025261956 7:57425768-57425790 TGGAGATCCCCGGCAGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025261947 Original CRISPR GACAGAGTGCTCGCTCCGAA GGG (reversed) Intergenic
No off target data available for this crispr