ID: 1025262149

View in Genome Browser
Species Human (GRCh38)
Location 7:57426530-57426552
Sequence CCCCTCACTCAGGATTCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025262139_1025262149 16 Left 1025262139 7:57426491-57426513 CCCCCACTTTCCAGGCGTGTCAT No data
Right 1025262149 7:57426530-57426552 CCCCTCACTCAGGATTCTCTAGG No data
1025262142_1025262149 13 Left 1025262142 7:57426494-57426516 CCACTTTCCAGGCGTGTCATAGG No data
Right 1025262149 7:57426530-57426552 CCCCTCACTCAGGATTCTCTAGG No data
1025262138_1025262149 22 Left 1025262138 7:57426485-57426507 CCTGGGCCCCCACTTTCCAGGCG No data
Right 1025262149 7:57426530-57426552 CCCCTCACTCAGGATTCTCTAGG No data
1025262135_1025262149 30 Left 1025262135 7:57426477-57426499 CCCAGGTGCCTGGGCCCCCACTT No data
Right 1025262149 7:57426530-57426552 CCCCTCACTCAGGATTCTCTAGG No data
1025262140_1025262149 15 Left 1025262140 7:57426492-57426514 CCCCACTTTCCAGGCGTGTCATA No data
Right 1025262149 7:57426530-57426552 CCCCTCACTCAGGATTCTCTAGG No data
1025262136_1025262149 29 Left 1025262136 7:57426478-57426500 CCAGGTGCCTGGGCCCCCACTTT No data
Right 1025262149 7:57426530-57426552 CCCCTCACTCAGGATTCTCTAGG No data
1025262145_1025262149 6 Left 1025262145 7:57426501-57426523 CCAGGCGTGTCATAGGGAGAGTC No data
Right 1025262149 7:57426530-57426552 CCCCTCACTCAGGATTCTCTAGG No data
1025262141_1025262149 14 Left 1025262141 7:57426493-57426515 CCCACTTTCCAGGCGTGTCATAG No data
Right 1025262149 7:57426530-57426552 CCCCTCACTCAGGATTCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025262149 Original CRISPR CCCCTCACTCAGGATTCTCT AGG Intergenic
No off target data available for this crispr