ID: 1025262768

View in Genome Browser
Species Human (GRCh38)
Location 7:57430799-57430821
Sequence AGTTGGTGACACATGGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025262768_1025262776 29 Left 1025262768 7:57430799-57430821 CCTAGCTCCATGTGTCACCAACT No data
Right 1025262776 7:57430851-57430873 AGCCTTCCGTGTCCACATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025262768 Original CRISPR AGTTGGTGACACATGGAGCT AGG (reversed) Intergenic
No off target data available for this crispr