ID: 1025262934

View in Genome Browser
Species Human (GRCh38)
Location 7:57432905-57432927
Sequence TTTTGTTTATGGAGGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025262934_1025262939 30 Left 1025262934 7:57432905-57432927 CCTTCTGCCCTCCATAAACAAAA No data
Right 1025262939 7:57432958-57432980 AAAATGCACACTGTGTCACCTGG No data
1025262934_1025262938 -10 Left 1025262934 7:57432905-57432927 CCTTCTGCCCTCCATAAACAAAA No data
Right 1025262938 7:57432918-57432940 ATAAACAAAATTGATGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025262934 Original CRISPR TTTTGTTTATGGAGGGCAGA AGG (reversed) Intergenic
No off target data available for this crispr