ID: 1025265624

View in Genome Browser
Species Human (GRCh38)
Location 7:57454528-57454550
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 570
Summary {0: 2, 1: 6, 2: 21, 3: 68, 4: 473}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025265620_1025265624 -9 Left 1025265620 7:57454514-57454536 CCCTGCAGATGTCCCAGCCTGCT 0: 5
1: 11
2: 13
3: 32
4: 294
Right 1025265624 7:57454528-57454550 CAGCCTGCTCACTCCAGCCATGG 0: 2
1: 6
2: 21
3: 68
4: 473
1025265621_1025265624 -10 Left 1025265621 7:57454515-57454537 CCTGCAGATGTCCCAGCCTGCTC 0: 8
1: 16
2: 16
3: 34
4: 269
Right 1025265624 7:57454528-57454550 CAGCCTGCTCACTCCAGCCATGG 0: 2
1: 6
2: 21
3: 68
4: 473
1025265619_1025265624 -5 Left 1025265619 7:57454510-57454532 CCTTCCCTGCAGATGTCCCAGCC 0: 2
1: 8
2: 19
3: 56
4: 383
Right 1025265624 7:57454528-57454550 CAGCCTGCTCACTCCAGCCATGG 0: 2
1: 6
2: 21
3: 68
4: 473
1025265618_1025265624 18 Left 1025265618 7:57454487-57454509 CCTAGTCAGTTCTTTCTAGGGAG 0: 3
1: 0
2: 7
3: 21
4: 143
Right 1025265624 7:57454528-57454550 CAGCCTGCTCACTCCAGCCATGG 0: 2
1: 6
2: 21
3: 68
4: 473

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900244804 1:1631991-1632013 CTGCCTGCTGTCTCCAGCCGGGG - Intergenic
900315084 1:2052350-2052372 GAGCCTGGTCTCTCCAGCCTGGG - Intronic
900660922 1:3783066-3783088 TAGCCACCTCACTCCAGCCTGGG + Intronic
900718446 1:4159912-4159934 CAGCCTGCTGAGTCCCGGCAGGG - Intergenic
900799601 1:4729019-4729041 CCTCCTGCTCACTCCAGCCCTGG + Intronic
901202993 1:7477116-7477138 CACCATGGTCACTCCTGCCAGGG - Intronic
901309626 1:8258792-8258814 CAGCCACTTCACTCCAGCCTGGG + Intergenic
901489374 1:9588929-9588951 CAGCGCGCTCACTCCCTCCATGG - Exonic
901571313 1:10163099-10163121 CTGCCAGTGCACTCCAGCCAAGG - Intronic
902225080 1:14991672-14991694 CAGCCTGGCCTCTCCAGCCTTGG - Intronic
902742485 1:18448583-18448605 CAGGCTGCTTAGGCCAGCCAGGG + Intergenic
903022073 1:20401581-20401603 CGCCCTGCTCACTCCTGCCCCGG + Intergenic
903805905 1:26005514-26005536 CATCCTGCTCACTCCTACCTGGG + Intergenic
904566017 1:31428899-31428921 CAGCCCACTCACACCAGCCAAGG - Intronic
904750205 1:32737221-32737243 AAGACTCCTCACTCCAGACAGGG - Intergenic
905068453 1:35204735-35204757 CAGCCACCGCACTCCAGCCTGGG + Intergenic
905404140 1:37721887-37721909 CAGCCTGCCCAGCTCAGCCAGGG - Intronic
906514357 1:46430133-46430155 CAGCCTCTTCACTGCAGCCTGGG - Intergenic
906793614 1:48679427-48679449 AAGCCTGCTCAGTACAACCAGGG + Intronic
906938436 1:50234964-50234986 CATCCTAGCCACTCCAGCCATGG + Intergenic
907185994 1:52609543-52609565 CAGCCTGTGCACTCTAGCCTGGG + Intergenic
908316591 1:62939001-62939023 CAGCCTGCTGACTTCAGGGAAGG - Intergenic
908533177 1:65052817-65052839 CAGTCTGGGCACTCCAGCCTGGG + Intergenic
908752224 1:67435340-67435362 CAGCCCGCGCACTCCAGCCTGGG - Intergenic
909621169 1:77669497-77669519 GCGCCTGTTCACTCCAGCCTGGG - Intronic
911342693 1:96657809-96657831 CAGCCTGTTCACTTGAGCCCAGG - Intergenic
912513582 1:110204376-110204398 CTGACTGCTCCCTCCACCCAGGG - Intergenic
912947804 1:114099104-114099126 CAGCCTGCTCATCTCAGTCATGG - Exonic
913659419 1:120993385-120993407 CTGCCAGCTAACTCCAGCAATGG + Intergenic
914010781 1:143776512-143776534 CTGCCAGCTAACTCCAGCAATGG + Intergenic
914167047 1:145184603-145184625 CTGCCAGCTAACTCCAGCAATGG - Intergenic
914385498 1:147165838-147165860 GAGCCTCCTCACTCCAGCCTGGG - Intronic
914649403 1:149685169-149685191 CTGCCAGCTAACTCCAGCAATGG + Intergenic
914769698 1:150673210-150673232 CGGCCAGGTCACTCCAGCCTAGG - Intronic
914828466 1:151153292-151153314 CACACTGCTCACTGCAGCCTTGG - Intergenic
915171431 1:153980708-153980730 CAGACTGATCACTCGAGCCCAGG + Intergenic
915201266 1:154231189-154231211 TAGCATGATCACTGCAGCCATGG + Intronic
916216114 1:162396669-162396691 CACCCTTCTCCCTCCAGCCTGGG - Exonic
917151879 1:171954660-171954682 ATGCCTGCTCACTCCTGCAAGGG + Intronic
917777474 1:178352894-178352916 CAGCTGTCTAACTCCAGCCATGG - Intronic
918045045 1:180936386-180936408 CAGCCTGAGCAGTCCAGCCAGGG - Exonic
919684857 1:200474251-200474273 CAGGCTTGTCACTGCAGCCAGGG - Intergenic
920253984 1:204641934-204641956 CACCCTCCTCTCTGCAGCCAGGG + Intronic
920673471 1:208022750-208022772 CAGCCTGCTCCCTCCTACCCTGG - Exonic
921941891 1:220849959-220849981 CAGGCGGATCACTTCAGCCAAGG - Intergenic
922239516 1:223746519-223746541 CATGCCGCTCACTCCAGCCTGGG - Intronic
922615572 1:226959375-226959397 CAGCCTTGACACTCCAGCCCGGG + Intronic
922918849 1:229283516-229283538 AAGCCTGCTCTCTGTAGCCATGG - Intronic
924239404 1:242026740-242026762 CTGCCTCTGCACTCCAGCCAGGG - Intergenic
924473782 1:244366215-244366237 CAGCCACTTCACTCCAGCCTGGG - Intronic
1063449494 10:6142049-6142071 CAGCCTCCTGACTCCAGCCCAGG + Intergenic
1064018276 10:11789587-11789609 CATCCTGCTCACATCATCCAAGG - Intergenic
1064262024 10:13793617-13793639 CAGCCTCCCCACTCCAGCCATGG - Intronic
1064288460 10:14012722-14012744 CAGCCTGGTCATTGCAGCCCAGG + Intronic
1064653229 10:17530464-17530486 CAGCCTCTGCACTCCAGCCTGGG + Intergenic
1065160422 10:22914372-22914394 CACCTTGCTCACTCCAGCCTGGG + Intergenic
1065612023 10:27481465-27481487 CAGCCTGCAGACTCCAGAAAAGG - Intergenic
1066652782 10:37674408-37674430 CAGCCACCACACTCCAGCCTGGG + Intergenic
1066975392 10:42363596-42363618 CAGCCCGCTCACCCCAGCCATGG - Intergenic
1067048826 10:43000618-43000640 CAGCCTGCTCTCTCCAGAAGAGG - Intergenic
1067211185 10:44261373-44261395 TCGCCTGCTCACTGCAGCCTGGG - Intergenic
1067570977 10:47370561-47370583 CAGCCTGCCTCTTCCAGCCATGG - Intronic
1067748189 10:48952301-48952323 CAGCCTACCCAATGCAGCCAGGG + Intronic
1068131570 10:52901782-52901804 CAACCTGCTTACTCCAGCTCAGG + Intergenic
1068215600 10:53978411-53978433 CATCCTAGCCACTCCAGCCATGG - Intronic
1069446761 10:68479773-68479795 CAGCCTGGGCACTCCAGCCTGGG + Exonic
1069734755 10:70646638-70646660 CAGGGTACCCACTCCAGCCAGGG - Intergenic
1071346182 10:84696262-84696284 GACCCTGCTGACACCAGCCACGG + Intergenic
1071687688 10:87778208-87778230 CAGGCAGATCACTCAAGCCAGGG + Intronic
1071851087 10:89571274-89571296 CACACTGCACACTCCAGCCTGGG - Intergenic
1072337881 10:94415703-94415725 CAGCCTGGGCACTCCAGCCTGGG + Intronic
1072403666 10:95129878-95129900 CATCCTGGCCACTACAGCCATGG + Intergenic
1072913986 10:99526181-99526203 CTGGCTTCTCACACCAGCCAAGG - Intergenic
1073101171 10:101007461-101007483 CTTCCAGCCCACTCCAGCCAGGG + Exonic
1073592571 10:104770788-104770810 CAGCCTCTGCACTCCAGCCTGGG + Intronic
1074424073 10:113335761-113335783 CACCCTGGTCTCCCCAGCCAAGG - Intergenic
1074563932 10:114559530-114559552 CATCCTGTCCACTACAGCCATGG - Intronic
1074630570 10:115250527-115250549 CTGCCAGCTCTTTCCAGCCAGGG - Intronic
1075194064 10:120339622-120339644 CAGCTTGGGCACTCCAGACATGG + Intergenic
1075629281 10:123991512-123991534 CAGCCATTTCACTCCAGCCTGGG + Intergenic
1076078505 10:127556763-127556785 CACCCTGCTCACTCCAAGCCAGG - Intergenic
1076300418 10:129421501-129421523 CAGCCTGCCCCCTCCAGCCATGG + Intergenic
1076870870 10:133193480-133193502 CAGCCATTGCACTCCAGCCAGGG + Intronic
1077056108 11:594025-594047 CAGCCTGGTCATTGCAGCCCTGG + Intronic
1077228441 11:1448333-1448355 CAGCCAGCACACTGCAGCCTTGG - Intronic
1077464161 11:2725678-2725700 CAGGCTGTGCACTCCAGCCGAGG + Intronic
1077574996 11:3376198-3376220 CAGACTGCTCACAGCAACCATGG - Intronic
1077942580 11:6859175-6859197 CATCCTAGCCACTCCAGCCATGG - Intergenic
1078117384 11:8466979-8467001 CATCCTAGCCACTCCAGCCATGG - Intronic
1078339878 11:10491110-10491132 CCGCCTCCTCACCCCAGCCCGGG + Intronic
1080038616 11:27735512-27735534 CAGCCATGTCACTCCAGACAGGG + Intergenic
1080628987 11:34055190-34055212 CAGCCTGGGCACTCCAGCCTGGG - Intronic
1081833821 11:46137039-46137061 CAGCCTGCTCGCCCCAGCCTCGG + Intergenic
1082283448 11:50296938-50296960 GCGCCACCTCACTCCAGCCAGGG + Intergenic
1083681456 11:64353694-64353716 CTCCCTTCTCACTCCTGCCAGGG + Exonic
1083877115 11:65530150-65530172 CTTCCTGCCCAATCCAGCCAGGG + Intronic
1084032446 11:66488892-66488914 TAGCCTGGGCACTCCAGCCTGGG - Intronic
1084878490 11:72152473-72152495 AAGCCACCTCACTCCAGCCTGGG - Intergenic
1085402091 11:76241402-76241424 CAGGCTCCTCACTCCTCCCAGGG + Intergenic
1085906818 11:80774246-80774268 CATCCCAGTCACTCCAGCCATGG + Intergenic
1087171791 11:95057291-95057313 CACCATGCTGACTTCAGCCATGG + Intergenic
1088143949 11:106652223-106652245 CAGCCTCCCCACTGGAGCCAAGG + Intergenic
1088469278 11:110176485-110176507 CCTCCTGCTCCCCCCAGCCACGG + Intronic
1088507492 11:110540761-110540783 CAGCCTGCTTGCTCCAGTCTGGG - Intergenic
1089570776 11:119407670-119407692 CAGCCTGGGCACTCCAGCCTGGG - Intergenic
1089812683 11:121144541-121144563 CAGCTTGCTCACTGCAGCAACGG - Intronic
1090050033 11:123369841-123369863 CAGCCTGGGCACTCCAGCCTGGG + Intergenic
1090426673 11:126611817-126611839 CAGCCTGATGGGTCCAGCCAAGG - Intronic
1090428750 11:126628766-126628788 CAGCCTGCTACCTGGAGCCAGGG + Intronic
1091168778 11:133502488-133502510 CACCCAGCTCACTCCAGCTCTGG - Intronic
1091923126 12:4321395-4321417 CTCCCTGCTCGCTCCAGCCCGGG + Intronic
1092570923 12:9720382-9720404 CAGCCACCGCACTCCAGCCTGGG - Intronic
1097056508 12:56253220-56253242 CAGACTGCTCACATCAACCATGG - Intronic
1097736164 12:63183336-63183358 CAACCTGCTGACTCCAAACATGG - Intergenic
1098125308 12:67286048-67286070 CAGCCACTGCACTCCAGCCAGGG - Intronic
1100185616 12:92135782-92135804 CAGTCTGGGCACTCCAGCCTGGG + Intronic
1100984457 12:100190899-100190921 CACCCTGTCCACTCCACCCAAGG + Intergenic
1101251469 12:102939860-102939882 CAGGCTGCACACTGCAGCCCTGG - Intronic
1101990086 12:109477316-109477338 CACCCAGCTCACGCCAGCCGGGG + Exonic
1102205976 12:111091178-111091200 CAGTGTTCCCACTCCAGCCAGGG + Intronic
1102868513 12:116393686-116393708 CAGGCAGATCACTCCAGCCCAGG + Intergenic
1102986696 12:117284261-117284283 CTGCCCGCTCACTGCTGCCACGG - Intronic
1103430607 12:120882086-120882108 CATCCTGCTCCCTCCTGCCTGGG + Intronic
1104061109 12:125269326-125269348 CACCCTGCTTTCTGCAGCCAAGG - Intronic
1104460062 12:128948070-128948092 CGGCCTTCCCACTCCAGCCTCGG - Intronic
1104792591 12:131493295-131493317 CAGCCTCCTCACACCTGCCCGGG - Intergenic
1105532469 13:21231966-21231988 CATGCTGCTAACTCCAGACAGGG + Intergenic
1105763831 13:23538053-23538075 CACCATGCGCACTCCAGCCTGGG + Intergenic
1105971109 13:25429864-25429886 CACCCTGCTGACTCCTGCCCAGG - Intronic
1106132499 13:26951870-26951892 CAGCCTGCTAATTCCAACCAAGG + Intergenic
1111327791 13:86722003-86722025 TAGCTGGCTCACACCAGCCATGG + Intergenic
1113200911 13:107867055-107867077 CAGCCCGCTCTCCCCTGCCAGGG + Intergenic
1113468698 13:110530079-110530101 CGCCCTGCTCACTGCAGACAGGG + Intronic
1113574589 13:111385686-111385708 CATCCTGCAAACCCCAGCCAGGG + Intergenic
1113784952 13:112997602-112997624 CAGCCTGATGGCTCCAGACAGGG + Intronic
1113966754 13:114157041-114157063 CAGCCTGGGCACTCCAGCCTGGG - Intergenic
1118320787 14:64752049-64752071 GAGCCAGTTCACTCCAGCCGGGG + Intronic
1118348802 14:64959054-64959076 AAACCAGCTCACTCCAGGCAGGG + Intronic
1119186088 14:72643576-72643598 ACCCCTCCTCACTCCAGCCAGGG - Intronic
1119336306 14:73836493-73836515 CAGCCAGTGCACTCCAGCCTGGG + Intergenic
1119338275 14:73852866-73852888 CAGCCAGGACACTCCAGCCTGGG - Intronic
1121310273 14:92932027-92932049 CAGCCTGTGCGCTCCTGCCATGG - Intronic
1121343669 14:93119661-93119683 TAGCCTCCACACTCCAGCCTGGG + Intergenic
1121565944 14:94909021-94909043 AAGCCTGCTGACTCCAAACATGG + Intergenic
1122537614 14:102476999-102477021 CTGCCACCTCACTCCAGCCTGGG + Intronic
1122906570 14:104804313-104804335 CAGGCTGCCCACCCCAGCAAAGG - Exonic
1124400542 15:29344163-29344185 CAGGCTGGCCACTCCAGCCCAGG - Intronic
1124671430 15:31644517-31644539 CACACTGCTGACTCCAGCCTAGG - Intronic
1124838234 15:33216173-33216195 CACCCTGCTCTCTCCAGACCTGG - Intergenic
1124879300 15:33626704-33626726 CAGCCACTTCACTCCAGCTATGG + Intronic
1125713810 15:41807577-41807599 CAGACTCCTCTCTCCAGCAAAGG - Intronic
1125832950 15:42729236-42729258 CAGCCTTCCCAGACCAGCCAGGG - Exonic
1126627316 15:50697330-50697352 CAGCCTGGGCACTCCAGCCTGGG + Intergenic
1126695326 15:51321089-51321111 CAGCCTGCTTACTTCATCCAGGG + Intronic
1127084530 15:55412733-55412755 CAGCCAGTGCACTCCAGCCTGGG + Intronic
1127390873 15:58504141-58504163 GAGCTTGTTCACTCCAGCCAGGG - Intronic
1127923233 15:63511611-63511633 CAGCCTCCTCACTATAGCTATGG + Intronic
1128016412 15:64351828-64351850 GAGCCTGGGCACTCCAGCCTGGG + Intronic
1128773951 15:70304367-70304389 CTGCCTCCTCAGTGCAGCCATGG - Intergenic
1129242568 15:74260228-74260250 CAGCTTGCTCCCTCCACCCTCGG - Intronic
1129299826 15:74619138-74619160 CAGCCAGCCACCTCCAGCCATGG - Intronic
1129712406 15:77827034-77827056 CAGGCACCTCATTCCAGCCATGG - Intergenic
1129986478 15:79923569-79923591 CACGCCGCTCACTCCAGCCGAGG + Exonic
1130025557 15:80267838-80267860 CACCCTGCCATCTCCAGCCAGGG + Intergenic
1130354147 15:83114611-83114633 CTGGCTGCTGACTCCAGGCAAGG + Intronic
1130367272 15:83251920-83251942 CAGCCTGCTGAGGCCAGGCATGG + Intergenic
1130573925 15:85073879-85073901 CTGCCTGCTCTCCCCAGTCAGGG + Intronic
1130964988 15:88690444-88690466 CAGCCTGCTCAGTGCAGCTGGGG - Intergenic
1131013449 15:89038535-89038557 CAGCCTGCTGACCTCAGCCAGGG - Intergenic
1131036465 15:89225708-89225730 CAGCCAGTACACTCCAGCCTGGG + Intergenic
1132322814 15:100938796-100938818 CACCCGGCCCTCTCCAGCCAAGG - Intronic
1132592682 16:733176-733198 GAGCCCCCACACTCCAGCCAGGG + Intronic
1132749785 16:1452218-1452240 CATCCTGCCCACTCCCGCCGTGG + Intronic
1132888179 16:2191604-2191626 CCCCCAGCTCTCTCCAGCCAGGG + Intronic
1133017997 16:2953787-2953809 CAGGCTGCTAGCACCAGCCACGG + Intergenic
1133232399 16:4372814-4372836 CACCCTGCACACTCCACCCCTGG - Intronic
1134884119 16:17774718-17774740 CACCCTCTTCACTCCAGCCTTGG + Intergenic
1135236482 16:20761135-20761157 CAGCCTGGGCACTCCAGCCTGGG - Intronic
1135712569 16:24729964-24729986 CAGCCTGCGCCCTCCCGCCGAGG - Intronic
1135835079 16:25818028-25818050 CAGCCTACTTCTTCCAGCCAAGG + Intronic
1136673292 16:31876892-31876914 CAGCCTGCTCACCCCATCCATGG + Intronic
1137284853 16:47006923-47006945 CAGCCACCGCACTCCAGCCTGGG + Intergenic
1137646110 16:50076238-50076260 CAGCCACCGCACTCCAGCCTGGG - Intronic
1137800702 16:51259671-51259693 CAGCCTTCTCTAACCAGCCAAGG - Intergenic
1137990411 16:53148306-53148328 CAGTCAGCTCACTGCAGCCTTGG + Intronic
1139361506 16:66402640-66402662 CAGGGTGATCACTGCAGCCAGGG - Exonic
1139513881 16:67442225-67442247 CAGCCAGCTCGCTCCAACCAGGG + Intronic
1140055947 16:71525907-71525929 CTGCCTGCTCACTCCACCCTGGG - Intronic
1140389308 16:74571609-74571631 CAGCCACCGCACTCCAGCCTGGG + Intronic
1141384216 16:83604307-83604329 CAGACTGCTCACTCTTGCCATGG + Intronic
1141646278 16:85369749-85369771 CAGCCAGCTCAGCCCAGCCAGGG - Intergenic
1141993982 16:87625528-87625550 CAGCATGCACACTGCAGCCAAGG + Intronic
1142729982 17:1847411-1847433 CAGCCCACTCTCTCCAGTCACGG + Intronic
1142876474 17:2854264-2854286 CAGGCTCCTCGCACCAGCCAGGG - Intronic
1142896124 17:2980319-2980341 AAGCTTGCTCAGTCCAGCCAAGG - Exonic
1143027977 17:3952125-3952147 CAGCCACCGCACTCCAGCCTGGG - Intronic
1143361619 17:6375775-6375797 CAGCCTGGGCACTCCAGCCTGGG + Intergenic
1143530316 17:7499170-7499192 CAGCCTGCTTCCCTCAGCCAGGG - Intronic
1143660013 17:8318934-8318956 CCTCCTGCCCACTCCAGCCTGGG - Intronic
1143765662 17:9135986-9136008 CATCCTCCTCACTCCCGCCTGGG + Intronic
1143904161 17:10196651-10196673 CAGCTGGCTCAGTCCAGCCAGGG + Intronic
1144349759 17:14383911-14383933 CAGCCTGGGCACTCCAGCATGGG - Intergenic
1145203769 17:20969536-20969558 CAGCTTGCCCACTCCAGCCCAGG - Intergenic
1146151315 17:30475147-30475169 AAGCCTTCTCTCTCCAGACAAGG + Intergenic
1146910123 17:36642923-36642945 CAGCCTCCTCACTCCACAGATGG + Intergenic
1147891878 17:43723100-43723122 TGGCCTGCTCTCTCCAGCAAAGG - Intergenic
1148484841 17:47984026-47984048 CTGCTTGCTAAATCCAGCCATGG + Intergenic
1148511954 17:48178391-48178413 CATTCTGCTCACTCCTGCCCAGG - Intronic
1149234114 17:54570588-54570610 CATCCCAGTCACTCCAGCCAGGG - Intergenic
1150756454 17:67918737-67918759 CATCAGGCTCACTCCAGCTAAGG - Exonic
1151206294 17:72510196-72510218 CAGCATGCTAACTGCGGCCATGG + Intergenic
1151534440 17:74730686-74730708 CAGTCTGCTCTCAGCAGCCAGGG + Intronic
1151776479 17:76206729-76206751 CAATCGGCTCACTCCAGCCTGGG + Intronic
1151896062 17:76981735-76981757 CAGCCTGCCCACCCCTGCCATGG + Intergenic
1152204562 17:78967627-78967649 CATCCTCCTCCCTCCAGCCCTGG - Intergenic
1152259834 17:79260921-79260943 CTGCCGGCACACTCCACCCAGGG + Intronic
1152425899 17:80218524-80218546 CAGCCTCCTCTGTCCATCCATGG - Intronic
1152648613 17:81481728-81481750 CAGCTTGTTCACTGCCGCCAGGG + Intergenic
1152664665 17:81560368-81560390 CTGCCTCTTCACTCCAGCCTGGG + Intronic
1152912330 17:83012524-83012546 CGGACGGCTCAGTCCAGCCACGG + Intronic
1153958040 18:10114980-10115002 CAGACTGCTCTGGCCAGCCAGGG + Intergenic
1155070000 18:22306646-22306668 CATTGTGCTCACTCCAGCCTGGG + Intergenic
1155555630 18:27016052-27016074 GACCCTGCTCATCCCAGCCATGG + Intronic
1156462207 18:37327437-37327459 CAGGGTGCTCATTCCAGCCTCGG - Intronic
1157288881 18:46395982-46396004 CTGCCTGGTCATTCCAGCCAAGG - Intronic
1157403306 18:47404027-47404049 CAGCTTGTTCTCTCCACCCATGG + Intergenic
1157555304 18:48609680-48609702 AAGCCACCTGACTCCAGCCAGGG + Intronic
1157688782 18:49664231-49664253 CAGCCTGGGGACTCCATCCAAGG + Intergenic
1157751158 18:50179689-50179711 CAGCCTGCTCTCTAAAGCCATGG + Intronic
1159208477 18:65284418-65284440 CAGCCATTGCACTCCAGCCAGGG + Intergenic
1160282177 18:77501483-77501505 CAGTCACCTCACTTCAGCCAAGG - Intergenic
1161344444 19:3761148-3761170 GAGTCTGTTCACTCCAGCCCTGG + Intronic
1161496247 19:4587500-4587522 CACCCAGCTCACTCCTGCCTCGG + Intergenic
1161540913 19:4850928-4850950 CAGTAGGATCACTCCAGCCAAGG + Intronic
1162176570 19:8833944-8833966 CAGCCGGTGCACTCCAGCCCGGG + Intronic
1162674776 19:12290757-12290779 CAGCCTAATCACTCCAGCAATGG - Intronic
1162682902 19:12360378-12360400 CCTCCGGATCACTCCAGCCATGG - Intronic
1162704826 19:12547650-12547672 CAGCCTTATCACTCCAACCAGGG - Intronic
1162956427 19:14101124-14101146 CAGAGTTCTCTCTCCAGCCAAGG - Intronic
1163288593 19:16364480-16364502 CACCCTGCTCTCTGCAGCCCCGG - Intronic
1163884536 19:19954162-19954184 CAGCCTGCTCACCCCAGCCATGG - Intergenic
1163908672 19:20169469-20169491 CAGCCTGCTCACCCCACCCATGG + Intronic
1163915048 19:20233833-20233855 CAGCCTGCTCACCCGAGCCATGG - Intergenic
1163933675 19:20422793-20422815 CAGCCTGCTCACCCCAGCTATGG - Intergenic
1163957729 19:20659903-20659925 AAGACTGCTCACCCCAGCCACGG - Intronic
1163983839 19:20926648-20926670 CAGCCTGCTCACCCCAGCCATGG + Intronic
1163993791 19:21024168-21024190 TAGCCTGCTCACTCTAGCTGTGG + Intronic
1163999662 19:21085694-21085716 CAGTCTGCTCACCCCAGCCATGG + Intronic
1164005585 19:21145546-21145568 CAGTCTGCTCAACCCAGCCATGG + Intronic
1164027175 19:21363409-21363431 TAGCCTGCTCACTCCAGTCATGG + Intronic
1164030644 19:21400644-21400666 CAGCCTGCTCACTCCAGCCATGG + Intronic
1164042917 19:21509599-21509621 CTGCCTGCTCACCCCAGCCATGG + Intronic
1164053270 19:21600995-21601017 TAGCCTGCTCACAATAGCCATGG - Intergenic
1164070537 19:21764093-21764115 CAGCCTTCTCACTGCAGCCATGG - Intronic
1164095529 19:22006596-22006618 CAGCCTGCTTACCGCAGCCATGG - Intronic
1164114998 19:22211281-22211303 CAGCCTGCTTACCGCAGCCATGG - Intergenic
1164123617 19:22290194-22290216 CAGCCTGCTCACCCCAGCCATGG + Intronic
1164176518 19:22780077-22780099 CAGCCTGCTCACCCCAGTCATGG - Intronic
1164183020 19:22836184-22836206 CAGCCTGCTCACCCTAGCCATGG + Intergenic
1164198806 19:22999446-22999468 CAGCCTGCTTACCCCAGCCATGG - Intronic
1164225934 19:23245978-23246000 TAGCCTGCTCACTCCAGCCATGG - Intronic
1164241302 19:23391758-23391780 CAGCTTGCTCACCTCAGCTATGG - Intronic
1164272147 19:23682583-23682605 CAGCCTGCTCACCCCAGCCATGG - Intronic
1164309621 19:24034287-24034309 CAGCCTGCTCACAATAGCCATGG + Intronic
1164449098 19:28344486-28344508 GAGCCGCCTCACTCCAGACATGG + Intergenic
1164625755 19:29726778-29726800 CAGCCATCGCACTCCAGCCTGGG - Intergenic
1164795593 19:31024849-31024871 CATGCTACTCACTCCAGCCTGGG + Intergenic
1165248054 19:34509154-34509176 CTGCCAGTGCACTCCAGCCAGGG + Exonic
1165398953 19:35585538-35585560 CACACTGCACACTCCAGCCTGGG - Intergenic
1165778418 19:38418236-38418258 CAGCCTGGGCATTCCAACCAAGG - Intronic
1165946004 19:39442743-39442765 CAGCCGGTGCACTCCAGCCTGGG - Intronic
1166197497 19:41216795-41216817 CAGCCACCGCACTCCAGCCTGGG + Intergenic
1166485315 19:43206865-43206887 CTGCCTGCCCACTGCAGCCCAGG - Intronic
1166569431 19:43784554-43784576 CAGCCAGCTGCCTCCAGCCCAGG + Intergenic
1168142035 19:54394750-54394772 CAGCCACCGCACTCCAGCCTGGG - Intergenic
1168501157 19:56894646-56894668 CACCCTGCTGACTCCAGGAAAGG - Intergenic
924962499 2:46681-46703 CCGCCTCCTCACTCCCGCCCGGG + Intronic
925085199 2:1102309-1102331 CAGCCTCCTCACAACAGCCAGGG - Intronic
925254540 2:2471918-2471940 CAGGCAGCTCAATCAAGCCAGGG - Intergenic
926375509 2:12223728-12223750 CTTCCTGGCCACTCCAGCCATGG + Intergenic
926382658 2:12305724-12305746 CAGGTTTCTCACTCCAGACATGG - Intergenic
926629193 2:15121361-15121383 CAACCTGCTCAGACAAGCCATGG + Intergenic
927134795 2:20088906-20088928 TAGCCTCCTTTCTCCAGCCATGG + Intergenic
927455691 2:23247457-23247479 CAGTTTGCTAACTCCAGCCCTGG - Intergenic
927808850 2:26171002-26171024 CAGCCCGCTCACCCTGGCCAGGG - Intergenic
928341079 2:30443746-30443768 CACCCTGCAGAGTCCAGCCAGGG + Intergenic
928526358 2:32145322-32145344 CAGGCTGCTCACTTGAGCCCGGG - Intronic
928684392 2:33733258-33733280 CAGCCACTGCACTCCAGCCAGGG - Intergenic
929452308 2:42046332-42046354 CACCCTGCAGACTGCAGCCACGG + Intergenic
929561734 2:42960551-42960573 CAGCCTGGGCACTCAGGCCACGG - Intergenic
930254577 2:49075865-49075887 CAGGTGGTTCACTCCAGCCAAGG - Intronic
930787671 2:55286414-55286436 CTGCCAGTACACTCCAGCCAGGG + Intergenic
930903431 2:56535961-56535983 CAACAGGATCACTCCAGCCAAGG - Intergenic
930998293 2:57749380-57749402 CATCCTGCTCCATCCAGTCATGG - Intergenic
931356428 2:61540725-61540747 CAGACTGTACACTCCAGCCTGGG + Intergenic
931448087 2:62343979-62344001 CAGCCTGCTTAATTCAGCCGTGG - Intergenic
932307501 2:70714472-70714494 CCTCCTCCTCAATCCAGCCAGGG + Intronic
932396729 2:71453892-71453914 CAGCCAGCCCTCTCCAGCGAGGG + Intronic
932438279 2:71716056-71716078 GACCCTGATGACTCCAGCCAAGG + Intergenic
932707492 2:74038009-74038031 CACCCTGCTCTCCCCACCCAGGG - Intronic
935064611 2:99636866-99636888 CAGCCAGCCCAGTGCAGCCAAGG + Intronic
935555885 2:104508953-104508975 TAGGCTGCTCTCTCCAGCCAGGG + Intergenic
935658372 2:105443999-105444021 GACCCAGCTCCCTCCAGCCAGGG - Intergenic
936811422 2:116407564-116407586 CATCCCAGTCACTCCAGCCATGG + Intergenic
937337591 2:121071383-121071405 CAGCCTGCTCCCTCCGGAAAAGG - Intergenic
937594126 2:123652357-123652379 CAGCCTGCTGAGCCTAGCCAGGG - Intergenic
937975417 2:127579439-127579461 CAGACTGCACACTTCGGCCAGGG + Intronic
940149063 2:150578875-150578897 CATCCTAGTCACTTCAGCCATGG - Intergenic
940743828 2:157544503-157544525 CAGCTTGATCATTCCAGCCACGG + Exonic
941356542 2:164500140-164500162 CCGTCCCCTCACTCCAGCCAGGG + Intronic
944334571 2:198515851-198515873 CAGCCATCGCACTCCAGCCTGGG + Intronic
944494346 2:200291210-200291232 CAGCCTGCTCAGTTCAGCCCAGG - Intergenic
946173138 2:217907149-217907171 CAGCCTTCTCACACCTGCCCAGG + Intronic
946396847 2:219447694-219447716 CAGCCTCCTCCCCCCAGCCCTGG - Intronic
947190977 2:227504233-227504255 CAGCCACCGCACTCCAGCCCGGG - Intronic
947214355 2:227736458-227736480 CAGCCAGCTCCCTCCTCCCAAGG - Intergenic
947443732 2:230146786-230146808 CTCCCTGCTCTCTCCAGCCCTGG - Intergenic
948087940 2:235266545-235266567 CAGCCAGCTCGCTCCTCCCAGGG + Intergenic
948934960 2:241157869-241157891 CCGCCTGCTCAGCCCAGCCTTGG + Intronic
949012716 2:241690489-241690511 CAGCCTGCTGACCTCAGCCCTGG + Intergenic
1168964465 20:1890960-1890982 CTGCCTGCTGACGCCAGCCCAGG + Intergenic
1168976442 20:1969632-1969654 CAGCCCCCTCACTCCCGCCAAGG + Intergenic
1169091362 20:2863112-2863134 CAGCCCGCTCACTGCACCCTTGG - Intronic
1170127136 20:12976279-12976301 CATTATACTCACTCCAGCCACGG + Intergenic
1172204164 20:33150552-33150574 CAGCCTGCTCTCTGCAGTGATGG + Intergenic
1172639140 20:36430614-36430636 CAGACAGCTCACTGCAGCCTTGG - Intronic
1172897643 20:38311806-38311828 CAGCCTCCTGAATCCAGCCCAGG + Intronic
1172972595 20:38884209-38884231 CAGCCTGCTCAGCCACGCCAGGG - Intronic
1173019243 20:39253449-39253471 CAGCCGCCTCACTCCAGCTGTGG + Intergenic
1174025613 20:47571754-47571776 CAGCCTGCAGACTGCAGCCTGGG - Intronic
1174321280 20:49743553-49743575 GAGCCACCTCACTCCAGCCTGGG - Intergenic
1174395785 20:50246249-50246271 CTGCCCTCTCCCTCCAGCCAGGG + Intergenic
1174696132 20:52560751-52560773 CAGCCTGGCCATTCCACCCAGGG - Intergenic
1176145013 20:63561689-63561711 CAGCCTGCTCACTGTACACACGG + Exonic
1176334679 21:5584971-5584993 AAGCCTACTCACACCAACCATGG - Intergenic
1176360951 21:5996021-5996043 CAGGCAGCTCACTCCACCCTGGG + Intergenic
1176393078 21:6235977-6235999 AAGCCTACTCACACCAACCATGG + Intergenic
1176468341 21:7080197-7080219 AAGCCTACTCACACCAACCATGG - Intronic
1176491902 21:7461975-7461997 AAGCCTACTCACACCAACCATGG - Intergenic
1176508740 21:7676408-7676430 AAGCCTACTCACACCAACCATGG + Intergenic
1177838952 21:26215412-26215434 GAGCCACCTCACTCCAGCCTGGG + Intergenic
1178166707 21:29986000-29986022 CAGCATGCCCACTCCAGCCATGG + Intergenic
1178909131 21:36660113-36660135 CAGCTTGCAAATTCCAGCCATGG + Intergenic
1179405004 21:41118588-41118610 CAGCCACCGCACTCCAGCCTGGG - Intergenic
1179446913 21:41438434-41438456 AGGCCCGGTCACTCCAGCCAAGG - Intronic
1179450160 21:41463139-41463161 CATCCTAGCCACTCCAGCCATGG + Intergenic
1179519175 21:41931198-41931220 GAGCCTGCTCACAGCAGCCGTGG + Intronic
1179681125 21:43022057-43022079 CCGCCTGCTCTCTCCTGCCCTGG - Intronic
1179762567 21:43542529-43542551 CAGGCAGCTCACTCCACCCTGGG - Intronic
1180103985 21:45605319-45605341 CAGGCAGCTCACTCCACCCTGGG + Intergenic
1180825627 22:18858945-18858967 CAGGCTGCTCACCCCAGGCCTGG - Intronic
1181175913 22:21035393-21035415 TAGCCTCTTCACTCCAGCCTGGG + Intergenic
1181316976 22:21977151-21977173 CAGCCACTTCACTCCAGCCTAGG + Intronic
1181405065 22:22678544-22678566 CACCCACCTCACTCAAGCCACGG + Intergenic
1181408220 22:22700189-22700211 CACCCACCTCACTCAAGCCACGG + Intergenic
1181423648 22:22819033-22819055 CAGGCTGCTCTCTTCAGCAAGGG + Intronic
1181746058 22:24955653-24955675 CAGCCTCCCCACACCAGCCAGGG - Intronic
1182330907 22:29551390-29551412 CAGCCACTTCACTCCAGCCTGGG + Intronic
1182830371 22:33300153-33300175 CAGCCTGCTCACTCTGTCGAAGG - Intronic
1183896311 22:40972126-40972148 CCGCCTGCTCACTCCCAACAGGG - Intronic
1184399522 22:44265780-44265802 CAGCTTGCACACCCCAGCGATGG + Intronic
1184484336 22:44766920-44766942 CAGCCTCCTCACTCCACCTGCGG - Intronic
1184810808 22:46830482-46830504 CAGACTGCACTTTCCAGCCAGGG - Intronic
1184926279 22:47642057-47642079 AAGCCTGCTCGCTCTAGCCAAGG + Intergenic
1185080647 22:48707755-48707777 CAGCCTTCCCCCTCCAGACACGG - Exonic
1185128020 22:49022533-49022555 CAGCCTTCCCACTCCAGGCTGGG - Intergenic
1185244090 22:49764006-49764028 CAGCCTGGGCACCCCACCCAAGG + Intergenic
1203214860 22_KI270731v1_random:541-563 CAGGCTGCTCACCCCAGGCCTGG + Intergenic
949562262 3:5213832-5213854 CTGCCGGCTCCCTCCAGGCAAGG - Intronic
950070045 3:10144537-10144559 CAGCCTCCACACTCCAGCCCAGG - Intronic
950716118 3:14848835-14848857 CTGACTTCTCACACCAGCCAGGG - Intronic
951533508 3:23720902-23720924 CAGCCTTGTCACTCCAGCTGAGG + Intergenic
953711252 3:45273036-45273058 CAGCCAGGCCACTCCAGCCCTGG + Intergenic
954218523 3:49138041-49138063 CAGGCTGCTCCCTCCAACCTGGG - Intergenic
954303368 3:49713094-49713116 CAGCCTGCTGATTCCAGGCTGGG + Intronic
954885546 3:53870265-53870287 CACCCTCCACACTGCAGCCAGGG + Intronic
955371595 3:58356473-58356495 CAGGCTGCTGACTCCAGCTCAGG + Intronic
956382379 3:68678539-68678561 CAGCCTTCTGACTCCTGCCGGGG + Intergenic
957299170 3:78368458-78368480 CTGCCACTTCACTCCAGCCAGGG + Intergenic
960311596 3:116123190-116123212 CAGGCAGCTCACTCCACCCTTGG - Intronic
960405439 3:117253681-117253703 AAGCCTCCTCCCTCCAGCCATGG - Intergenic
962009784 3:131381803-131381825 CAGCCTGCGGGCTCCGGCCATGG - Exonic
962321826 3:134396773-134396795 CTGCCTGCCCTTTCCAGCCAGGG - Intergenic
962355040 3:134686430-134686452 CAGCCTGCTGACCCTAGCCCAGG - Intronic
964541385 3:157783417-157783439 CAGCCTGTGCACTCTAGCCTGGG - Intergenic
964746140 3:160014381-160014403 GAGCCACATCACTCCAGCCAAGG - Intergenic
967084933 3:186085968-186085990 CAGACTCCGCACTGCAGCCATGG + Intronic
967951500 3:194844567-194844589 CAGCCACTTCACTCCAGCCTGGG + Intergenic
968117561 3:196101222-196101244 CAGCCTGGGCACTCCAGCCTGGG - Intergenic
968427531 4:533592-533614 CAGCCTGGGCACTGCAGGCAGGG + Intronic
968842322 4:3016487-3016509 CAGCCTGTGTACTCCAGCCTGGG + Intronic
970721522 4:18995029-18995051 CTGCCTGGCCACCCCAGCCATGG + Intergenic
971242009 4:24897843-24897865 CAGGCTGCTCAGTCAAGCCTGGG - Intronic
971775340 4:30956183-30956205 CAGCCTGGGCACTCCAGCCTGGG + Intronic
971914632 4:32851708-32851730 CAACCTACTGACACCAGCCAGGG - Intergenic
973659825 4:53093012-53093034 CACTGTGCACACTCCAGCCATGG - Intronic
975473467 4:74795165-74795187 GAGCCACTTCACTCCAGCCAAGG + Intergenic
976053101 4:81031283-81031305 CAGCCTGCTCGCCCCAGCCATGG - Exonic
977133582 4:93272712-93272734 CAGTCTTCTCACTCCTGCCATGG - Intronic
977964108 4:103123287-103123309 CATCCTGCTCAGTCCTGCCTGGG + Intronic
978338324 4:107694107-107694129 CAGCCTCTGCACTCCAGCCTGGG - Intronic
981631770 4:146827146-146827168 GAGCCCCCTCCCTCCAGCCAAGG - Intronic
982122327 4:152155186-152155208 CCACTTGCTCTCTCCAGCCATGG + Intergenic
982497641 4:156110666-156110688 CAGCGTGCTGAATCTAGCCAAGG + Intergenic
982975331 4:162049366-162049388 CAGTCAGTTCACTCCAGCTAGGG - Intronic
983340477 4:166454673-166454695 CATCCCGGCCACTCCAGCCATGG + Intergenic
983503175 4:168523657-168523679 AAGCCTGGTCACTCCAGTCCAGG + Intronic
984811409 4:183798414-183798436 CGGCCCGCGCACTCCAGCCGCGG - Intergenic
985849161 5:2375913-2375935 CCGTGTGCTCACTCCAGGCATGG + Intergenic
986006407 5:3672414-3672436 CTCCCTGCACACTCCAGCCATGG - Intergenic
991486939 5:67147023-67147045 CAGCCTGCTCACTACCGGAAAGG + Intronic
992291885 5:75287912-75287934 ATGCCAGCTCACTCCAGCCCGGG - Intergenic
992684813 5:79188962-79188984 TAGGCTGCCCACTCCAGCCTGGG - Intronic
992893099 5:81221946-81221968 CAGCCTATGCACTCCAGCCTGGG + Intronic
995152295 5:108863160-108863182 AAGCCTCTTCACTCCAGCCTGGG - Intronic
997093282 5:130882229-130882251 CAGCCTGTTCACTGCAGAGAGGG + Intergenic
997250129 5:132382313-132382335 CACCATGCCCCCTCCAGCCATGG + Intronic
997346347 5:133195262-133195284 CAGCCAGCTCTCTCCAGTCTTGG + Intergenic
998294312 5:140952293-140952315 CAGCCATTTCACTCCAGCCTGGG + Intronic
999919750 5:156305313-156305335 CATCCCAGTCACTCCAGCCATGG + Intronic
1000009488 5:157218005-157218027 CAGCCTGCTGCATGCAGCCAGGG - Intronic
1000288790 5:159850480-159850502 CAGCTTACTCACTCCAGAGATGG + Intergenic
1000501495 5:162056600-162056622 CAGCCACCACACTCCAGCCTAGG + Intergenic
1000522819 5:162318864-162318886 CATCCTAGGCACTCCAGCCATGG + Intergenic
1000609600 5:163359784-163359806 CACCCTAGCCACTCCAGCCATGG + Intergenic
1001048179 5:168391614-168391636 CAGCCACTTCACTCCAGCCTGGG + Intronic
1002322222 5:178382823-178382845 CAGCCTTCTGACTCCTGCCAAGG - Intronic
1002874961 6:1202560-1202582 CTCCCTCCTCACCCCAGCCATGG + Intergenic
1003390206 6:5707182-5707204 CATGCTGCTAACTCCAGACAGGG - Intronic
1004059281 6:12176274-12176296 CAGCCATCACACTCCAGCCTGGG - Intergenic
1004718464 6:18242542-18242564 CATCCTGCTCACTCCTGCCCGGG + Intronic
1005838974 6:29728058-29728080 CCTCCTCCTCACTCCAGTCATGG - Intronic
1006237422 6:32646516-32646538 CACTGTGCTCACTCCAGCCTAGG + Intronic
1006303379 6:33205674-33205696 CAGCCCAATCACTCCAGCCTTGG - Exonic
1006536272 6:34701452-34701474 CACACTGCACACTCCAGCCTGGG - Intergenic
1006865765 6:37207949-37207971 CAGACAGCACACTCCAGCCTCGG - Intergenic
1006873215 6:37272290-37272312 CAGGCAGATCACTTCAGCCAAGG - Intronic
1006915232 6:37589673-37589695 CAGTCTGATCACCCCAGCTAAGG + Intergenic
1007090913 6:39184434-39184456 CAGCCTGGGCACTCCAGCCTGGG + Intergenic
1007917135 6:45571774-45571796 CACTGTGCTCACTCCAGCCTGGG - Intronic
1009720397 6:67461198-67461220 TAGCCTGGTAGCTCCAGCCATGG - Intergenic
1009980480 6:70720759-70720781 CAGCCTCTCCGCTCCAGCCATGG - Intronic
1010283181 6:74043551-74043573 CAGCCTGCTCACCACAGCAGGGG + Intergenic
1010767600 6:79794066-79794088 CAGGCTGCTCTGTCCAGCCATGG - Intergenic
1010842137 6:80658910-80658932 CAGCCACCGCACTCCAGCCTGGG - Intergenic
1010915639 6:81614537-81614559 AAGCCTGCTCACTGCAGCTGGGG + Intronic
1012075029 6:94672550-94672572 CAGTCTCCTCCCACCAGCCATGG - Intergenic
1012111734 6:95243785-95243807 GAGCCTGCTCACTGCAGAGATGG - Intergenic
1013446580 6:110235174-110235196 CAGCCACCGCACTCCAGCCTGGG - Intronic
1014996520 6:128152440-128152462 CAGTGTACTCACTCCAGCTAGGG - Intronic
1015019574 6:128456273-128456295 CTGCCTTCACATTCCAGCCAGGG + Intronic
1015022600 6:128494155-128494177 CAGCCACCGCACTCCAGCCTGGG + Intronic
1015353725 6:132252447-132252469 CAGCCAGGAGACTCCAGCCAGGG - Intergenic
1015710754 6:136137224-136137246 CAGCCACCACACTCCAGCCTGGG + Intronic
1017291876 6:152746403-152746425 CATCCTGCCCAGTCCAGCCTGGG - Intergenic
1018070929 6:160163800-160163822 CGTCCTGCTCAGACCAGCCAGGG - Intergenic
1018446679 6:163864835-163864857 ATGCCACCTCACTCCAGCCAGGG - Intergenic
1018784370 6:167096776-167096798 CAGCCTCCGCACTCCATCCTGGG - Intergenic
1020567052 7:9810976-9810998 CTGCCACCTCACTCCAGCCTGGG + Intergenic
1020997077 7:15278717-15278739 CAGCCTACTCACTCCCTCCCTGG + Intronic
1022257920 7:28677844-28677866 CAGCCACTTCACTCCAGCCTGGG + Intronic
1022377549 7:29828754-29828776 CAGCCTGCTCCCTGCTGGCAAGG + Intronic
1022500254 7:30878260-30878282 CAGGCTTCTCACTGCAGCCTGGG + Intronic
1023286329 7:38624523-38624545 TATCCTGCTCACTACAGTCATGG + Intronic
1023827168 7:44017365-44017387 AGGACTGCACACTCCAGCCAGGG - Intergenic
1024651059 7:51403803-51403825 CAGCCTGGGCAATCCAGCCTGGG + Intergenic
1024760656 7:52593164-52593186 CATCCTGCTCCCTCTTGCCAGGG - Intergenic
1024783250 7:52876146-52876168 CAGCCTGTTCACTCCAGACAAGG - Intergenic
1025055186 7:55759380-55759402 CAGCCTGGGCAATCCAGCCTGGG + Intergenic
1025133258 7:56389609-56389631 CAGCCTGGGCAATCCAGCCTGGG + Intergenic
1025236300 7:57237020-57237042 CACCCAGCACACTCCACCCAGGG + Intergenic
1025265624 7:57454528-57454550 CAGCCTGCTCACTCCAGCCATGG + Intronic
1025719039 7:63992571-63992593 CAACCTGCTCACCCCAGCCATGG + Intergenic
1025747186 7:64253411-64253433 CAGCCTGCTCACACCAGCAAAGG + Intronic
1025775646 7:64558509-64558531 CAGGCTGCTCACCCCAGCCATGG + Intronic
1025778833 7:64581584-64581606 CAGCTTGCTCACACCAGCCGTGG + Intergenic
1025788968 7:64669993-64670015 TCCCCTGCTCACCCCAGCCATGG + Intronic
1025798551 7:64762341-64762363 CAGCCTACTCACCTCAGCCATGG + Intergenic
1025802271 7:64797574-64797596 GAGCCTGCTCACCCCAGCCATGG + Intronic
1025824935 7:65003122-65003144 CAGCCTGCTCACTCTAGCCATGG - Intronic
1026006437 7:66603686-66603708 CAGCCTCTGCACTCCAGCCTGGG + Intergenic
1026480392 7:70773828-70773850 CAGCTTGCTCTCTCCAGCAATGG - Intronic
1026949028 7:74334957-74334979 CAGCCTGGGGACTCCAGCCTGGG + Intronic
1027218028 7:76196748-76196770 CAGCCTCCTCCCTACAGCCTAGG - Intergenic
1028145716 7:87317990-87318012 CACCCTGCTCACCCCTGCCCAGG - Intergenic
1028658718 7:93241347-93241369 CAGACTGGCCACTCCACCCAAGG - Intronic
1029222342 7:99000536-99000558 CACTCTGCGCACTCCAGCCTTGG + Intronic
1029477437 7:100793298-100793320 CAGCCTGGGCACTCCAGCCTGGG + Intronic
1029738320 7:102477111-102477133 AGGACTGCACACTCCAGCCAGGG - Intronic
1029755450 7:102570767-102570789 AGGACTGCACACTCCAGCCAGGG - Intronic
1029773399 7:102669847-102669869 AGGACTGCACACTCCAGCCAGGG - Intronic
1033236777 7:139644388-139644410 CAGCCTGCACACTCAAGCCTGGG + Intronic
1034258329 7:149736766-149736788 CAGGCTGCTCATTCCATCCTGGG + Intergenic
1034939364 7:155220442-155220464 CTCACTGCTCACTCCCGCCAAGG + Intergenic
1035012463 7:155731607-155731629 CATCCTGCTCCGTCCAGCCCGGG - Intronic
1035464468 7:159065440-159065462 CAGCCTCCACTCTCCAGCCACGG - Intronic
1035581929 8:745982-746004 CGGCCTGCTCAGGCCAGCCAAGG + Intergenic
1035787387 8:2272343-2272365 CAGCCTCCCCATTCAAGCCAGGG - Intergenic
1035805420 8:2449373-2449395 CAGCCTCCCCATTCAAGCCAGGG + Intergenic
1037242928 8:16797838-16797860 CAACCTGCTCCATCCAGCCCAGG - Intergenic
1038423056 8:27445943-27445965 CAGCCTCCTCAGTCCGGGCAGGG - Intronic
1038424890 8:27458662-27458684 CAGCCTGAGCAGTACAGCCAGGG - Exonic
1038454116 8:27661067-27661089 GAGCCTGCTCACGCCAGGGAGGG + Intronic
1040288348 8:46111776-46111798 CAGCCTGCTCAGGACAGCCCTGG + Intergenic
1040301222 8:46188993-46189015 CAGCCTGCCCACAACAGCCCTGG - Intergenic
1040518398 8:48153474-48153496 AAGCCTGCTCTCTCCAACCAAGG + Intergenic
1042798951 8:72696610-72696632 CAGGCTGCTCTCTCCATCCACGG - Intronic
1042923086 8:73939525-73939547 CATCCTAGCCACTCCAGCCATGG + Intronic
1044019193 8:87083629-87083651 CAGCCACCGCACTCCAGCCTGGG - Intronic
1044333156 8:90945104-90945126 AAGCCTGGGCACTCCAGCCTGGG - Intronic
1044720600 8:95142119-95142141 CAACCTGCTCACTACATTCAAGG - Intronic
1045046656 8:98285380-98285402 AAGCCTGGTAACTCCAGCCTTGG + Intronic
1046929024 8:119824684-119824706 CATCCTATCCACTCCAGCCAGGG + Intronic
1047239445 8:123072854-123072876 CAGCCCGCGCCCTCCCGCCACGG - Intronic
1047568259 8:126070118-126070140 AATCCTGCTCACTCTAGCCCTGG - Intergenic
1047836187 8:128695734-128695756 AAGCCTGATCTCTCTAGCCAAGG - Intergenic
1049286839 8:141780498-141780520 CATCCTGCACAGTCCACCCAGGG - Intergenic
1050296267 9:4208522-4208544 AATCCTGCCCACTCCAGCAATGG - Intronic
1055720293 9:79165682-79165704 TAGCCTCCTAACTCCAACCAAGG + Intergenic
1056013537 9:82357619-82357641 CAGCCACCTCACTCCAGCCTGGG + Intergenic
1056412587 9:86345916-86345938 TAGCCAGTTCACTCCAGCCAGGG - Intronic
1056702056 9:88918947-88918969 CATCTCACTCACTCCAGCCATGG - Intergenic
1056707984 9:88967882-88967904 CAGCCACTTCACTCCAGCCTGGG + Intergenic
1057228356 9:93304257-93304279 CTCCCTCCCCACTCCAGCCATGG - Intronic
1057353364 9:94317898-94317920 CAGCCAGCTCTCTCCATCCCAGG + Intergenic
1057557364 9:96098601-96098623 GACCCTGCTCACTGCAGCCTTGG - Intergenic
1057654387 9:96939694-96939716 CAGCCAGCTCTCTCCATCCCAGG - Intronic
1058386408 9:104441590-104441612 CATCCATCTCACTCCATCCAGGG - Intergenic
1058674808 9:107391191-107391213 CAGCCTGGGCACTCTAGCCTGGG - Intergenic
1059435287 9:114272257-114272279 CAGCCTTCTCACTCCACTCTGGG + Intronic
1059484636 9:114617252-114617274 CAGGCAGGGCACTCCAGCCAGGG - Exonic
1059506230 9:114802293-114802315 ACGCCAGCTCACTCCAGCCTGGG - Intronic
1059923170 9:119180018-119180040 CAGCCTGGGCTCCCCAGCCAGGG - Intronic
1059988175 9:119839923-119839945 CAGCCTCCCCGCACCAGCCATGG - Intergenic
1060391788 9:123283866-123283888 CAGGCTGGGCACTCCAGCCTGGG - Intergenic
1060662188 9:125410999-125411021 CAGCCCCCTGCCTCCAGCCAGGG + Intergenic
1060945270 9:127566757-127566779 CACCCTCCTCACCCCACCCAAGG - Intronic
1061808146 9:133147909-133147931 AGGCCTCCTCACTCCAACCAGGG + Intronic
1062008996 9:134257073-134257095 CTGGCTGCCCACTCCAGCCTCGG - Intergenic
1062268899 9:135699862-135699884 CAGCCCGCCCACTCCCACCAGGG - Intergenic
1062322623 9:135997886-135997908 CCTCCTGCACACTCCAGCCTGGG + Intergenic
1062373195 9:136250822-136250844 CAGCCTGCCTTCTCCAGCCCCGG - Intergenic
1185929022 X:4181441-4181463 CAGCCTCTGCACTCCAGCCTGGG + Intergenic
1186414647 X:9372614-9372636 CAGCCACCGCACTCCAGCCTAGG + Intergenic
1186844214 X:13515080-13515102 CAGGCTTCTCACTCTTGCCAGGG - Intergenic
1187460304 X:19480775-19480797 GAGCCTGTGCACTCCAGCCTGGG + Intronic
1189088705 X:38054769-38054791 CAGCCACTACACTCCAGCCAGGG - Intronic
1189142479 X:38621099-38621121 AAGCCTTCTCACTCAAGACATGG - Intronic
1189304387 X:39975625-39975647 CAGCCTGCTCTCAGCAGACAGGG - Intergenic
1190483806 X:50904265-50904287 CAGCCACCTCCCTCCAGCCTGGG - Intergenic
1190991109 X:55551629-55551651 AAACCTGCTTACTCTAGCCAAGG + Intergenic
1191860922 X:65666367-65666389 GAGCCAGTGCACTCCAGCCAGGG - Intronic
1192316656 X:70057365-70057387 AAGCCTGTTTTCTCCAGCCAAGG + Intergenic
1192367585 X:70487235-70487257 CAGCCTGCACTGTCCAGCTAAGG - Intronic
1192756382 X:74050198-74050220 CAGGCTGCACACCACAGCCACGG - Intergenic
1194039668 X:88924379-88924401 CAGTCAGCCCACTCCAGCCTGGG + Intergenic
1194631976 X:96296329-96296351 CAGCCTGAACACACCAGCAAAGG - Intergenic
1194864318 X:99047842-99047864 CAGGCTCCTCACTCCAGCATTGG + Intergenic
1195662906 X:107398814-107398836 CAGCCACCGCACTCCAGCCTGGG - Intergenic
1195937928 X:110143017-110143039 CAGGCTGCTCTCCCCAACCAAGG - Intronic
1196798667 X:119522905-119522927 AAGCGTGGTCACTCCCGCCAGGG + Intergenic
1196907589 X:120452779-120452801 CAGGCTGATCACTTGAGCCAGGG - Intronic
1197216490 X:123871557-123871579 GAGCCTGGCCACTCCAGCCTGGG - Intronic
1197716866 X:129715528-129715550 CAGCCACTTCACTCCAGCCTGGG + Intergenic
1200002181 X:153067687-153067709 CAGCCTGCTCCAGCCTGCCAGGG - Intergenic
1200005552 X:153082338-153082360 CAGCCTGCTCCAGCCTGCCAGGG + Intergenic
1200403719 Y:2787019-2787041 CAGCCAGCTCACCGCAGCAACGG - Exonic
1200909417 Y:8517036-8517058 CTGCATGCTCATACCAGCCACGG - Intergenic
1200965944 Y:9038486-9038508 ATGCCTGTGCACTCCAGCCAGGG - Intergenic
1201449309 Y:14093960-14093982 CAGCCACTTCACTCCAGCCTGGG - Intergenic