ID: 1025275778

View in Genome Browser
Species Human (GRCh38)
Location 7:57580467-57580489
Sequence CAGTATAGCCCCAGATAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025275778_1025275784 -4 Left 1025275778 7:57580467-57580489 CCTGGCTATCTGGGGCTATACTG No data
Right 1025275784 7:57580486-57580508 ACTGCCCGTGGTGGCAGGGGTGG No data
1025275778_1025275789 1 Left 1025275778 7:57580467-57580489 CCTGGCTATCTGGGGCTATACTG No data
Right 1025275789 7:57580491-57580513 CCGTGGTGGCAGGGGTGGTGGGG No data
1025275778_1025275783 -7 Left 1025275778 7:57580467-57580489 CCTGGCTATCTGGGGCTATACTG No data
Right 1025275783 7:57580483-57580505 TATACTGCCCGTGGTGGCAGGGG No data
1025275778_1025275787 0 Left 1025275778 7:57580467-57580489 CCTGGCTATCTGGGGCTATACTG No data
Right 1025275787 7:57580490-57580512 CCCGTGGTGGCAGGGGTGGTGGG No data
1025275778_1025275781 -9 Left 1025275778 7:57580467-57580489 CCTGGCTATCTGGGGCTATACTG No data
Right 1025275781 7:57580481-57580503 GCTATACTGCCCGTGGTGGCAGG No data
1025275778_1025275785 -1 Left 1025275778 7:57580467-57580489 CCTGGCTATCTGGGGCTATACTG No data
Right 1025275785 7:57580489-57580511 GCCCGTGGTGGCAGGGGTGGTGG No data
1025275778_1025275792 6 Left 1025275778 7:57580467-57580489 CCTGGCTATCTGGGGCTATACTG No data
Right 1025275792 7:57580496-57580518 GTGGCAGGGGTGGTGGGGGGAGG No data
1025275778_1025275791 3 Left 1025275778 7:57580467-57580489 CCTGGCTATCTGGGGCTATACTG No data
Right 1025275791 7:57580493-57580515 GTGGTGGCAGGGGTGGTGGGGGG No data
1025275778_1025275790 2 Left 1025275778 7:57580467-57580489 CCTGGCTATCTGGGGCTATACTG No data
Right 1025275790 7:57580492-57580514 CGTGGTGGCAGGGGTGGTGGGGG No data
1025275778_1025275782 -8 Left 1025275778 7:57580467-57580489 CCTGGCTATCTGGGGCTATACTG No data
Right 1025275782 7:57580482-57580504 CTATACTGCCCGTGGTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025275778 Original CRISPR CAGTATAGCCCCAGATAGCC AGG (reversed) Intergenic
No off target data available for this crispr