ID: 1025275970

View in Genome Browser
Species Human (GRCh38)
Location 7:57581278-57581300
Sequence TCCAGCTGGCCAGGAATTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025275970_1025275981 24 Left 1025275970 7:57581278-57581300 CCAGCAATTCCTGGCCAGCTGGA No data
Right 1025275981 7:57581325-57581347 AAGGCACTCACTCCCACCCCAGG No data
1025275970_1025275977 -7 Left 1025275970 7:57581278-57581300 CCAGCAATTCCTGGCCAGCTGGA No data
Right 1025275977 7:57581294-57581316 AGCTGGACTTGGCCAGGGGCCGG No data
1025275970_1025275979 5 Left 1025275970 7:57581278-57581300 CCAGCAATTCCTGGCCAGCTGGA No data
Right 1025275979 7:57581306-57581328 CCAGGGGCCGGTTTCAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025275970 Original CRISPR TCCAGCTGGCCAGGAATTGC TGG (reversed) Intergenic
No off target data available for this crispr