ID: 1025278938

View in Genome Browser
Species Human (GRCh38)
Location 7:57612094-57612116
Sequence TATTATCTTTAGAAGTTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025278936_1025278938 7 Left 1025278936 7:57612064-57612086 CCCACTGGGGCTATTGAGGTAGT No data
Right 1025278938 7:57612094-57612116 TATTATCTTTAGAAGTTTTATGG No data
1025278937_1025278938 6 Left 1025278937 7:57612065-57612087 CCACTGGGGCTATTGAGGTAGTT No data
Right 1025278938 7:57612094-57612116 TATTATCTTTAGAAGTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025278938 Original CRISPR TATTATCTTTAGAAGTTTTA TGG Intergenic
No off target data available for this crispr