ID: 1025278938 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:57612094-57612116 |
| Sequence | TATTATCTTTAGAAGTTTTA TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1025278936_1025278938 | 7 | Left | 1025278936 | 7:57612064-57612086 | CCCACTGGGGCTATTGAGGTAGT | No data | ||
| Right | 1025278938 | 7:57612094-57612116 | TATTATCTTTAGAAGTTTTATGG | No data | ||||
| 1025278937_1025278938 | 6 | Left | 1025278937 | 7:57612065-57612087 | CCACTGGGGCTATTGAGGTAGTT | No data | ||
| Right | 1025278938 | 7:57612094-57612116 | TATTATCTTTAGAAGTTTTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1025278938 | Original CRISPR | TATTATCTTTAGAAGTTTTA TGG | Intergenic | ||
| No off target data available for this crispr | |||||