ID: 1025280367

View in Genome Browser
Species Human (GRCh38)
Location 7:57622585-57622607
Sequence CAGGCTGCACACCTGGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025280367_1025280375 18 Left 1025280367 7:57622585-57622607 CCTGTGCCCAGGTGTGCAGCCTG No data
Right 1025280375 7:57622626-57622648 ATAGAGCCTAGGTGTACGGTAGG No data
1025280367_1025280373 14 Left 1025280367 7:57622585-57622607 CCTGTGCCCAGGTGTGCAGCCTG No data
Right 1025280373 7:57622622-57622644 TGCCATAGAGCCTAGGTGTACGG No data
1025280367_1025280372 7 Left 1025280367 7:57622585-57622607 CCTGTGCCCAGGTGTGCAGCCTG No data
Right 1025280372 7:57622615-57622637 TAGGCTGTGCCATAGAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025280367 Original CRISPR CAGGCTGCACACCTGGGCAC AGG (reversed) Intergenic
No off target data available for this crispr