ID: 1025281653

View in Genome Browser
Species Human (GRCh38)
Location 7:57629915-57629937
Sequence GACCGCCTGAACCTCCGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025281650_1025281653 -7 Left 1025281650 7:57629899-57629921 CCGCTTGCGACACCGGGACCGCC No data
Right 1025281653 7:57629915-57629937 GACCGCCTGAACCTCCGCCAGGG No data
1025281642_1025281653 24 Left 1025281642 7:57629868-57629890 CCCTCCGGCCCCAAGGAGGCATC No data
Right 1025281653 7:57629915-57629937 GACCGCCTGAACCTCCGCCAGGG No data
1025281644_1025281653 20 Left 1025281644 7:57629872-57629894 CCGGCCCCAAGGAGGCATCACTC No data
Right 1025281653 7:57629915-57629937 GACCGCCTGAACCTCCGCCAGGG No data
1025281646_1025281653 15 Left 1025281646 7:57629877-57629899 CCCAAGGAGGCATCACTCACAGC No data
Right 1025281653 7:57629915-57629937 GACCGCCTGAACCTCCGCCAGGG No data
1025281641_1025281653 25 Left 1025281641 7:57629867-57629889 CCCCTCCGGCCCCAAGGAGGCAT No data
Right 1025281653 7:57629915-57629937 GACCGCCTGAACCTCCGCCAGGG No data
1025281645_1025281653 16 Left 1025281645 7:57629876-57629898 CCCCAAGGAGGCATCACTCACAG No data
Right 1025281653 7:57629915-57629937 GACCGCCTGAACCTCCGCCAGGG No data
1025281643_1025281653 23 Left 1025281643 7:57629869-57629891 CCTCCGGCCCCAAGGAGGCATCA No data
Right 1025281653 7:57629915-57629937 GACCGCCTGAACCTCCGCCAGGG No data
1025281647_1025281653 14 Left 1025281647 7:57629878-57629900 CCAAGGAGGCATCACTCACAGCC No data
Right 1025281653 7:57629915-57629937 GACCGCCTGAACCTCCGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025281653 Original CRISPR GACCGCCTGAACCTCCGCCA GGG Intergenic
No off target data available for this crispr