ID: 1025283176

View in Genome Browser
Species Human (GRCh38)
Location 7:57642856-57642878
Sequence CTGTCTGGTAAGAGGAACTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025283171_1025283176 10 Left 1025283171 7:57642823-57642845 CCGAAGTGGAATTTTCTGCTCTC 0: 3
1: 1
2: 0
3: 20
4: 253
Right 1025283176 7:57642856-57642878 CTGTCTGGTAAGAGGAACTTGGG No data
1025283170_1025283176 23 Left 1025283170 7:57642810-57642832 CCAGGTGTGTGTGCCGAAGTGGA 0: 4
1: 1
2: 0
3: 12
4: 109
Right 1025283176 7:57642856-57642878 CTGTCTGGTAAGAGGAACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025283176 Original CRISPR CTGTCTGGTAAGAGGAACTT GGG Intergenic
No off target data available for this crispr