ID: 1025284351

View in Genome Browser
Species Human (GRCh38)
Location 7:57650144-57650166
Sequence ACAGAGCAGAAGAAGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025284340_1025284351 24 Left 1025284340 7:57650097-57650119 CCAGAGCGAGAGGCATCTAGGCC No data
Right 1025284351 7:57650144-57650166 ACAGAGCAGAAGAAGCAGGAGGG No data
1025284346_1025284351 3 Left 1025284346 7:57650118-57650140 CCAGGGGAGGCAGAGCAAGAGGG No data
Right 1025284351 7:57650144-57650166 ACAGAGCAGAAGAAGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025284351 Original CRISPR ACAGAGCAGAAGAAGCAGGA GGG Intergenic
No off target data available for this crispr