ID: 1025284827

View in Genome Browser
Species Human (GRCh38)
Location 7:57652765-57652787
Sequence CATCTTCTCTGACGTGTGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025284825_1025284827 -6 Left 1025284825 7:57652748-57652770 CCGTGAAAAGATACAACCATCTT No data
Right 1025284827 7:57652765-57652787 CATCTTCTCTGACGTGTGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025284827 Original CRISPR CATCTTCTCTGACGTGTGTC CGG Intergenic
No off target data available for this crispr