ID: 1025285151

View in Genome Browser
Species Human (GRCh38)
Location 7:57654533-57654555
Sequence CAGTTGTTCCACGGTTTCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025285151_1025285162 19 Left 1025285151 7:57654533-57654555 CCGTGGAAACCGTGGAACAACTG No data
Right 1025285162 7:57654575-57654597 TAAGCGGAGGTGTGCCAAACGGG No data
1025285151_1025285156 3 Left 1025285151 7:57654533-57654555 CCGTGGAAACCGTGGAACAACTG No data
Right 1025285156 7:57654559-57654581 ACCACCGCCAAGGGCATAAGCGG No data
1025285151_1025285154 -7 Left 1025285151 7:57654533-57654555 CCGTGGAAACCGTGGAACAACTG No data
Right 1025285154 7:57654549-57654571 ACAACTGGAAACCACCGCCAAGG No data
1025285151_1025285161 18 Left 1025285151 7:57654533-57654555 CCGTGGAAACCGTGGAACAACTG No data
Right 1025285161 7:57654574-57654596 ATAAGCGGAGGTGTGCCAAACGG No data
1025285151_1025285155 -6 Left 1025285151 7:57654533-57654555 CCGTGGAAACCGTGGAACAACTG No data
Right 1025285155 7:57654550-57654572 CAACTGGAAACCACCGCCAAGGG No data
1025285151_1025285158 6 Left 1025285151 7:57654533-57654555 CCGTGGAAACCGTGGAACAACTG No data
Right 1025285158 7:57654562-57654584 ACCGCCAAGGGCATAAGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025285151 Original CRISPR CAGTTGTTCCACGGTTTCCA CGG (reversed) Intergenic
No off target data available for this crispr