ID: 1025287179

View in Genome Browser
Species Human (GRCh38)
Location 7:57673717-57673739
Sequence CAGTAAAAGTATTTTGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025287179_1025287180 5 Left 1025287179 7:57673717-57673739 CCAGACTCAAAATACTTTTACTG No data
Right 1025287180 7:57673745-57673767 ATTCCATGTTTTATTTACTGAGG No data
1025287179_1025287182 8 Left 1025287179 7:57673717-57673739 CCAGACTCAAAATACTTTTACTG No data
Right 1025287182 7:57673748-57673770 CCATGTTTTATTTACTGAGGAGG No data
1025287179_1025287183 24 Left 1025287179 7:57673717-57673739 CCAGACTCAAAATACTTTTACTG No data
Right 1025287183 7:57673764-57673786 GAGGAGGCAAACCATACTAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025287179 Original CRISPR CAGTAAAAGTATTTTGAGTC TGG (reversed) Intergenic
No off target data available for this crispr