ID: 1025287633

View in Genome Browser
Species Human (GRCh38)
Location 7:57679257-57679279
Sequence TTCAACTCATTCTTCAAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025287633_1025287635 1 Left 1025287633 7:57679257-57679279 CCAGATTTGAAGAATGAGTTGAA No data
Right 1025287635 7:57679281-57679303 TTTACTGGAGACATAAATAGAGG No data
1025287633_1025287637 6 Left 1025287633 7:57679257-57679279 CCAGATTTGAAGAATGAGTTGAA No data
Right 1025287637 7:57679286-57679308 TGGAGACATAAATAGAGGAAGGG No data
1025287633_1025287636 5 Left 1025287633 7:57679257-57679279 CCAGATTTGAAGAATGAGTTGAA No data
Right 1025287636 7:57679285-57679307 CTGGAGACATAAATAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025287633 Original CRISPR TTCAACTCATTCTTCAAATC TGG (reversed) Intergenic
No off target data available for this crispr