ID: 1025287637

View in Genome Browser
Species Human (GRCh38)
Location 7:57679286-57679308
Sequence TGGAGACATAAATAGAGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025287633_1025287637 6 Left 1025287633 7:57679257-57679279 CCAGATTTGAAGAATGAGTTGAA No data
Right 1025287637 7:57679286-57679308 TGGAGACATAAATAGAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025287637 Original CRISPR TGGAGACATAAATAGAGGAA GGG Intergenic
No off target data available for this crispr