ID: 1025288802

View in Genome Browser
Species Human (GRCh38)
Location 7:57693515-57693537
Sequence GAATCTCTAATTGGGCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025288802_1025288805 17 Left 1025288802 7:57693515-57693537 CCAGTCAGCCCAATTAGAGATTC No data
Right 1025288805 7:57693555-57693577 TTCTGTGAATGTATTGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025288802 Original CRISPR GAATCTCTAATTGGGCTGAC TGG (reversed) Intergenic
No off target data available for this crispr