ID: 1025291211

View in Genome Browser
Species Human (GRCh38)
Location 7:57726092-57726114
Sequence ATGCTTACCTTGAAAGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025291211_1025291212 14 Left 1025291211 7:57726092-57726114 CCTCTTTCTTTCAAGGTAAGCAT No data
Right 1025291212 7:57726129-57726151 CTTTGCTCTTCTTCTTAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025291211 Original CRISPR ATGCTTACCTTGAAAGAAAG AGG (reversed) Intergenic
No off target data available for this crispr