ID: 1025295922

View in Genome Browser
Species Human (GRCh38)
Location 7:57775293-57775315
Sequence TTTGCTGTCCAAGACAGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025295922_1025295927 8 Left 1025295922 7:57775293-57775315 CCATACCTGTCTTGGACAGCAAA No data
Right 1025295927 7:57775324-57775346 GGTCTCCATGTCCAAAGTGATGG No data
1025295922_1025295931 26 Left 1025295922 7:57775293-57775315 CCATACCTGTCTTGGACAGCAAA No data
Right 1025295931 7:57775342-57775364 GATGGCTGTGTAGTCGGTCCAGG No data
1025295922_1025295930 20 Left 1025295922 7:57775293-57775315 CCATACCTGTCTTGGACAGCAAA No data
Right 1025295930 7:57775336-57775358 CAAAGTGATGGCTGTGTAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025295922 Original CRISPR TTTGCTGTCCAAGACAGGTA TGG (reversed) Intergenic
No off target data available for this crispr