ID: 1025295923

View in Genome Browser
Species Human (GRCh38)
Location 7:57775298-57775320
Sequence GGAGCTTTGCTGTCCAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025295923_1025295932 30 Left 1025295923 7:57775298-57775320 CCTGTCTTGGACAGCAAAGCTCC No data
Right 1025295932 7:57775351-57775373 GTAGTCGGTCCAGGAAGAGCAGG No data
1025295923_1025295930 15 Left 1025295923 7:57775298-57775320 CCTGTCTTGGACAGCAAAGCTCC No data
Right 1025295930 7:57775336-57775358 CAAAGTGATGGCTGTGTAGTCGG No data
1025295923_1025295931 21 Left 1025295923 7:57775298-57775320 CCTGTCTTGGACAGCAAAGCTCC No data
Right 1025295931 7:57775342-57775364 GATGGCTGTGTAGTCGGTCCAGG No data
1025295923_1025295927 3 Left 1025295923 7:57775298-57775320 CCTGTCTTGGACAGCAAAGCTCC No data
Right 1025295927 7:57775324-57775346 GGTCTCCATGTCCAAAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025295923 Original CRISPR GGAGCTTTGCTGTCCAAGAC AGG (reversed) Intergenic
No off target data available for this crispr