ID: 1025295926

View in Genome Browser
Species Human (GRCh38)
Location 7:57775320-57775342
Sequence CACTTTGGACATGGAGACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025295926_1025295932 8 Left 1025295926 7:57775320-57775342 CCTTGGTCTCCATGTCCAAAGTG No data
Right 1025295932 7:57775351-57775373 GTAGTCGGTCCAGGAAGAGCAGG No data
1025295926_1025295933 11 Left 1025295926 7:57775320-57775342 CCTTGGTCTCCATGTCCAAAGTG No data
Right 1025295933 7:57775354-57775376 GTCGGTCCAGGAAGAGCAGGAGG No data
1025295926_1025295935 25 Left 1025295926 7:57775320-57775342 CCTTGGTCTCCATGTCCAAAGTG No data
Right 1025295935 7:57775368-57775390 AGCAGGAGGTGACCTGACCGTGG No data
1025295926_1025295930 -7 Left 1025295926 7:57775320-57775342 CCTTGGTCTCCATGTCCAAAGTG No data
Right 1025295930 7:57775336-57775358 CAAAGTGATGGCTGTGTAGTCGG No data
1025295926_1025295931 -1 Left 1025295926 7:57775320-57775342 CCTTGGTCTCCATGTCCAAAGTG No data
Right 1025295931 7:57775342-57775364 GATGGCTGTGTAGTCGGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025295926 Original CRISPR CACTTTGGACATGGAGACCA AGG (reversed) Intergenic
No off target data available for this crispr