ID: 1025295927

View in Genome Browser
Species Human (GRCh38)
Location 7:57775324-57775346
Sequence GGTCTCCATGTCCAAAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025295922_1025295927 8 Left 1025295922 7:57775293-57775315 CCATACCTGTCTTGGACAGCAAA No data
Right 1025295927 7:57775324-57775346 GGTCTCCATGTCCAAAGTGATGG No data
1025295923_1025295927 3 Left 1025295923 7:57775298-57775320 CCTGTCTTGGACAGCAAAGCTCC No data
Right 1025295927 7:57775324-57775346 GGTCTCCATGTCCAAAGTGATGG No data
1025295920_1025295927 25 Left 1025295920 7:57775276-57775298 CCTGGAGCTCTGGGCTTCCATAC No data
Right 1025295927 7:57775324-57775346 GGTCTCCATGTCCAAAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025295927 Original CRISPR GGTCTCCATGTCCAAAGTGA TGG Intergenic
No off target data available for this crispr