ID: 1025295929

View in Genome Browser
Species Human (GRCh38)
Location 7:57775335-57775357
Sequence CGACTACACAGCCATCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025295929_1025295933 -4 Left 1025295929 7:57775335-57775357 CCAAAGTGATGGCTGTGTAGTCG No data
Right 1025295933 7:57775354-57775376 GTCGGTCCAGGAAGAGCAGGAGG No data
1025295929_1025295935 10 Left 1025295929 7:57775335-57775357 CCAAAGTGATGGCTGTGTAGTCG No data
Right 1025295935 7:57775368-57775390 AGCAGGAGGTGACCTGACCGTGG No data
1025295929_1025295938 29 Left 1025295929 7:57775335-57775357 CCAAAGTGATGGCTGTGTAGTCG No data
Right 1025295938 7:57775387-57775409 GTGGCTGACCTTTGTTTTCTAGG No data
1025295929_1025295932 -7 Left 1025295929 7:57775335-57775357 CCAAAGTGATGGCTGTGTAGTCG No data
Right 1025295932 7:57775351-57775373 GTAGTCGGTCCAGGAAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025295929 Original CRISPR CGACTACACAGCCATCACTT TGG (reversed) Intergenic
No off target data available for this crispr