ID: 1025295930

View in Genome Browser
Species Human (GRCh38)
Location 7:57775336-57775358
Sequence CAAAGTGATGGCTGTGTAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025295925_1025295930 -6 Left 1025295925 7:57775319-57775341 CCCTTGGTCTCCATGTCCAAAGT No data
Right 1025295930 7:57775336-57775358 CAAAGTGATGGCTGTGTAGTCGG No data
1025295923_1025295930 15 Left 1025295923 7:57775298-57775320 CCTGTCTTGGACAGCAAAGCTCC No data
Right 1025295930 7:57775336-57775358 CAAAGTGATGGCTGTGTAGTCGG No data
1025295926_1025295930 -7 Left 1025295926 7:57775320-57775342 CCTTGGTCTCCATGTCCAAAGTG No data
Right 1025295930 7:57775336-57775358 CAAAGTGATGGCTGTGTAGTCGG No data
1025295922_1025295930 20 Left 1025295922 7:57775293-57775315 CCATACCTGTCTTGGACAGCAAA No data
Right 1025295930 7:57775336-57775358 CAAAGTGATGGCTGTGTAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025295930 Original CRISPR CAAAGTGATGGCTGTGTAGT CGG Intergenic
No off target data available for this crispr