ID: 1025295932

View in Genome Browser
Species Human (GRCh38)
Location 7:57775351-57775373
Sequence GTAGTCGGTCCAGGAAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025295929_1025295932 -7 Left 1025295929 7:57775335-57775357 CCAAAGTGATGGCTGTGTAGTCG No data
Right 1025295932 7:57775351-57775373 GTAGTCGGTCCAGGAAGAGCAGG No data
1025295926_1025295932 8 Left 1025295926 7:57775320-57775342 CCTTGGTCTCCATGTCCAAAGTG No data
Right 1025295932 7:57775351-57775373 GTAGTCGGTCCAGGAAGAGCAGG No data
1025295923_1025295932 30 Left 1025295923 7:57775298-57775320 CCTGTCTTGGACAGCAAAGCTCC No data
Right 1025295932 7:57775351-57775373 GTAGTCGGTCCAGGAAGAGCAGG No data
1025295925_1025295932 9 Left 1025295925 7:57775319-57775341 CCCTTGGTCTCCATGTCCAAAGT No data
Right 1025295932 7:57775351-57775373 GTAGTCGGTCCAGGAAGAGCAGG No data
1025295928_1025295932 -1 Left 1025295928 7:57775329-57775351 CCATGTCCAAAGTGATGGCTGTG No data
Right 1025295932 7:57775351-57775373 GTAGTCGGTCCAGGAAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025295932 Original CRISPR GTAGTCGGTCCAGGAAGAGC AGG Intergenic
No off target data available for this crispr