ID: 1025300256

View in Genome Browser
Species Human (GRCh38)
Location 7:57814331-57814353
Sequence ATGTGTTCAGGGAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025300256_1025300265 15 Left 1025300256 7:57814331-57814353 CCTGCTTCCCTCCCTGAACACAT No data
Right 1025300265 7:57814369-57814391 TACAATTCAAGTTGAGATGTGGG 0: 18
1: 789
2: 9208
3: 10419
4: 8549
1025300256_1025300267 20 Left 1025300256 7:57814331-57814353 CCTGCTTCCCTCCCTGAACACAT No data
Right 1025300267 7:57814374-57814396 TTCAAGTTGAGATGTGGGTAGGG 0: 13
1: 59
2: 1508
3: 10926
4: 12036
1025300256_1025300266 19 Left 1025300256 7:57814331-57814353 CCTGCTTCCCTCCCTGAACACAT No data
Right 1025300266 7:57814373-57814395 ATTCAAGTTGAGATGTGGGTAGG 0: 19
1: 803
2: 9954
3: 11012
4: 9580
1025300256_1025300264 14 Left 1025300256 7:57814331-57814353 CCTGCTTCCCTCCCTGAACACAT No data
Right 1025300264 7:57814368-57814390 ATACAATTCAAGTTGAGATGTGG 0: 15
1: 591
2: 971
3: 9250
4: 10680

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025300256 Original CRISPR ATGTGTTCAGGGAGGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr