ID: 1025301849

View in Genome Browser
Species Human (GRCh38)
Location 7:57824526-57824548
Sequence CTGAATCTTCAGATGAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 6, 1: 0, 2: 2, 3: 20, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025301849_1025301857 22 Left 1025301849 7:57824526-57824548 CCTCCCCTCATCTGAAGATTCAG 0: 6
1: 0
2: 2
3: 20
4: 186
Right 1025301857 7:57824571-57824593 TTTGTGTCATACCAACACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025301849 Original CRISPR CTGAATCTTCAGATGAGGGG AGG (reversed) Intergenic
901040027 1:6358239-6358261 CTGCATCTCCAGAAGAGGGAAGG + Intronic
903820282 1:26096789-26096811 CTGTATCTTGAGATGGGTGGTGG - Intergenic
904605736 1:31696662-31696684 CAGACTCTTCTGATGAGGGCAGG - Intronic
905389168 1:37625285-37625307 CAGAGGCTTGAGATGAGGGGTGG + Intronic
907345739 1:53778143-53778165 CTGAATATTCAGATTAAGTGGGG - Intronic
907518945 1:55010754-55010776 CTGAGTCTTCGGATGAGGTGAGG + Exonic
910410109 1:86934201-86934223 GTGAAACCTCGGATGAGGGGAGG + Intronic
910511501 1:88011557-88011579 TTGAATCAGCAGATGAGAGGTGG - Intergenic
911819382 1:102397890-102397912 CTGAATATTCAAATGAGATGAGG + Intergenic
917745102 1:177999127-177999149 CTGAATCCCCAGATGAGAAGCGG + Intergenic
920455961 1:206101326-206101348 CAGCATCCTCAGGTGAGGGGGGG + Intronic
920850300 1:209623829-209623851 CTGATCCTTCAGGTGAGGAGAGG - Exonic
1063448364 10:6134501-6134523 CTGAAACTTCAGCTGAATGGAGG + Intergenic
1063487414 10:6432906-6432928 CAGAATTTAAAGATGAGGGGAGG - Intronic
1063680126 10:8179223-8179245 CTGATTCTTCTGCTGGGGGGAGG + Intergenic
1063942954 10:11149397-11149419 CTGCATCTGCTGATGAGGGTGGG - Intronic
1064749139 10:18508369-18508391 CTGAATCCACAGAGGAAGGGAGG + Intronic
1065921265 10:30395022-30395044 CTGTATCTTGAGCTGAGTGGTGG - Intergenic
1066250252 10:33626175-33626197 CTGAATCTGCAGGTGATGGGAGG + Intergenic
1067344088 10:45425634-45425656 CTGAGTCTGCAGGTGAGGGTGGG - Intronic
1070288689 10:75100945-75100967 CTGAAACTGCAGCTGAGAGGTGG - Intronic
1072958078 10:99904503-99904525 CTGAAACATCCGATGAGGGAAGG - Intronic
1073597927 10:104818442-104818464 GTGAATCTTAAGAGGTGGGGAGG + Intronic
1076587592 10:131559965-131559987 CTGACTCCTCAGAAGAGAGGAGG + Intergenic
1076835816 10:133020573-133020595 CTGGATCTTGGGGTGAGGGGAGG - Intergenic
1076946732 10:133656684-133656706 TTGTAGCTTCAGGTGAGGGGAGG - Intergenic
1078824594 11:14916908-14916930 CTGTATCTTCACATGATGGAAGG + Intronic
1082006111 11:47420016-47420038 CTGTGCCTTCAGATGAGGGGTGG + Intronic
1083333210 11:61908690-61908712 CTGAATGATCAGAGGAGGTGTGG + Intronic
1084010526 11:66346019-66346041 CTGACTTCTCAGATTAGGGGAGG + Exonic
1085236141 11:75017100-75017122 CAGCATCTTCATATAAGGGGTGG - Intronic
1087180129 11:95133817-95133839 CTGAAGGTACAGATGAGGGTTGG + Intergenic
1089497976 11:118917285-118917307 CTGACTAATCAAATGAGGGGAGG + Intronic
1089572396 11:119419268-119419290 CTGGAACTCCTGATGAGGGGTGG + Exonic
1094385992 12:29894916-29894938 CTGCATCTTCCCATGATGGGAGG + Intergenic
1095573874 12:43712644-43712666 CTGAAACTTGAGAAGAGGGAGGG + Intergenic
1097354464 12:58586041-58586063 TTGAATTTTCAGATTAGGGATGG + Intronic
1100026476 12:90134693-90134715 CTGTATCTTCAAATGGTGGGGGG + Intergenic
1100451457 12:94710921-94710943 CTGTATCTACAGAGAAGGGGAGG + Intergenic
1101489007 12:105194837-105194859 CTGTATGTTCAGATAAGGCGTGG + Intronic
1101788846 12:107910625-107910647 CTAAATCTTCAGGGAAGGGGTGG + Intergenic
1102767953 12:115449941-115449963 CTGAATGGTTAGATGAGTGGGGG - Intergenic
1103672872 12:122632668-122632690 CTGCATATTCAGATGATGTGGGG + Intergenic
1104211416 12:126692218-126692240 CTGGGTCTTCAGATGGTGGGGGG - Intergenic
1106027755 13:25971495-25971517 CTGAAAGATCAGATGAGGGTAGG - Intronic
1107918427 13:45177333-45177355 CTGAAACTGCAGATGGGAGGTGG - Intronic
1108254923 13:48600819-48600841 CATAGTCTTCAGATGGGGGGTGG + Intergenic
1108579362 13:51815453-51815475 CTGACACTTCTGATGAAGGGAGG + Intergenic
1110031495 13:70619847-70619869 TTGAAACATCAGATGTGGGGGGG - Intergenic
1113101734 13:106727509-106727531 CTGACTCCTCAGATGAGGCCAGG + Intergenic
1113165374 13:107434864-107434886 ATGAATCTTCACATGAGAGTGGG + Intronic
1113198973 13:107843534-107843556 CTGATTCTTCAGGTCTGGGGTGG - Intronic
1113717620 13:112524321-112524343 TTGAATCTGCAGATGTGGGGCGG + Intronic
1114377440 14:22163330-22163352 CTGCATCTTCACAGGAGGGATGG + Intergenic
1119121571 14:72084128-72084150 CTGGATCTTGAGGGGAGGGGAGG + Intronic
1119406674 14:74403337-74403359 CTGAATTTGCAGCTGAGGGTAGG + Intergenic
1122305396 14:100762959-100762981 GTAAATCTTCAGATGGGGTGAGG + Intergenic
1122600329 14:102918132-102918154 CAGAGTCTGCAGATGAGGGGTGG + Intergenic
1125933925 15:43618440-43618462 CTGGATCTAAAGATGAGGTGAGG + Intronic
1125947022 15:43717902-43717924 CTGGATCTAAAGATGAGGTGAGG + Intergenic
1126331895 15:47541666-47541688 CTGTATCTACAGATGATCGGGGG + Intronic
1126481563 15:49128029-49128051 CTGGATCATCAGAAGAGGGGTGG - Exonic
1127631412 15:60831246-60831268 TTGAAACTTCTAATGAGGGGAGG + Intronic
1127669751 15:61183987-61184009 CTGAATTAACAGATGAGGAGAGG - Intronic
1129404420 15:75305726-75305748 CTGTATCTTGAGCTGAGTGGTGG + Intergenic
1129836144 15:78707811-78707833 CTGTATCTTGAGCTGAGTGGCGG + Intronic
1130034157 15:80342281-80342303 CTCCATCTTAAGATGTGGGGAGG - Intergenic
1130940963 15:88508681-88508703 CTGCAGTTTCAGAGGAGGGGTGG + Intergenic
1132360601 15:101210596-101210618 CTGCATCTTAAGAGCAGGGGTGG + Intronic
1134871616 16:17657160-17657182 CTGAAGCCTGAGATCAGGGGAGG - Intergenic
1138361065 16:56427552-56427574 CTGAAACTTCACATGAATGGGGG + Intergenic
1139069464 16:63362603-63362625 CTGAACATTCAGAGGTGGGGTGG + Intergenic
1139595217 16:67953953-67953975 CTGAATCTTCTGATTTGGGGGGG - Intronic
1141289165 16:82701856-82701878 CTGTGTCTTCAGAAGAGGGGAGG - Intronic
1141740050 16:85885116-85885138 CTGAATCCAGAGATGGGGGGTGG - Intergenic
1143272824 17:5688496-5688518 TGGCATCGTCAGATGAGGGGAGG + Intergenic
1143367415 17:6417133-6417155 CTACATCTTCAAATGATGGGTGG + Intronic
1145282577 17:21478489-21478511 ATGAAACCTCACATGAGGGGCGG - Intergenic
1145304870 17:21668275-21668297 CTGAATCTTCAGATGAGGGGAGG + Intergenic
1145737044 17:27240350-27240372 CTCAGTCTTCTGATGAAGGGGGG - Intergenic
1146636365 17:34508465-34508487 CTGGAGATTCAGATGTGGGGAGG - Intergenic
1146821691 17:35987979-35988001 CTGATGATTCAGATGAGGAGAGG - Intronic
1147062254 17:37889934-37889956 CTGAATCTCCAGATGAGGTTAGG + Intergenic
1147905286 17:43818534-43818556 CTGAGCCTTCCGCTGAGGGGAGG - Intronic
1148263098 17:46201416-46201438 TTGAATTTTCAGATTAGGGATGG - Intronic
1148970902 17:51480393-51480415 CTAAATCTTCATATGGGTGGTGG - Intergenic
1149200619 17:54181919-54181941 CTGAATCCTCACATGATGGAAGG - Intergenic
1149318346 17:55459506-55459528 CTGAATCTCAAGGTGAGGGTAGG + Intergenic
1149400475 17:56290864-56290886 GTTAATTTTCAGAGGAGGGGAGG - Intronic
1150836986 17:68573257-68573279 CTGACTTTTCACATGAGGTGAGG - Intronic
1150872864 17:68932799-68932821 TTGAAGCTTGAGATGAGGGGTGG - Intronic
1154459810 18:14570828-14570850 CTGAGTCTGCAGATGAATGGAGG + Intergenic
1156534562 18:37850080-37850102 CTGTATCTTCAGTTAGGGGGAGG - Intergenic
1160272775 18:77403222-77403244 CTGTTTCTTCAGATTTGGGGTGG - Intergenic
1162955716 19:14096885-14096907 CTGAGGGTTCAGATGAGGGGTGG - Intronic
1165636915 19:37348018-37348040 CATAATCTTCAGTTGAGGGAGGG + Intronic
1166238593 19:41474159-41474181 CTTAATATTCAGAGGAGGAGAGG - Intergenic
1166801612 19:45461169-45461191 CTGAGGCTCCAGAGGAGGGGAGG - Intronic
1166917686 19:46206800-46206822 CTGCAGCTTCAGGAGAGGGGAGG + Intergenic
1167904047 19:52643752-52643774 AGGAATCTTCAGATGGGGGTGGG + Intronic
925355101 2:3235313-3235335 CTTATTCTTCAGATGAAGGCCGG - Intronic
926017462 2:9467149-9467171 CTGAAACTCCAGATTAAGGGGGG + Intronic
927364549 2:22278857-22278879 CTGAGGCTTCAAAAGAGGGGAGG - Intergenic
929268111 2:39941423-39941445 CTGAATCTTCACTTGGTGGGAGG + Intergenic
932404358 2:71503679-71503701 CTGAATCTGGAGAAGAGGGCTGG - Intronic
933710802 2:85324455-85324477 CTGATTCATTAGATGTGGGGTGG - Intronic
935390085 2:102541834-102541856 CTGAATCAGCAGATGTGGGGTGG + Intergenic
940106664 2:150108849-150108871 CTGTATCTTCAGTTGAAGGATGG + Intergenic
940281193 2:151991431-151991453 CTCCATCTTCAGGTGAGAGGAGG - Intronic
943243523 2:185418267-185418289 CTGATTCAGCAGCTGAGGGGTGG - Intergenic
945171123 2:206996189-206996211 CAGAATCTTCAGATGACTGGGGG + Intergenic
947821294 2:233072932-233072954 CTGCCTCTTCAGTTCAGGGGTGG - Intronic
948127282 2:235573753-235573775 CTGACTCTCCAGATGAGCCGGGG - Intronic
1169218323 20:3806021-3806043 CTGAATCTCAAGATGGGGGCAGG + Exonic
1171143786 20:22764670-22764692 CTTAACCATCAGATGAGGTGTGG + Intergenic
1171522379 20:25785715-25785737 CTGAATCTTCAGATGAGGGGAGG + Intronic
1171530128 20:25847660-25847682 CTGAATCTTCAGATGAGGGGAGG + Intronic
1171554448 20:26070168-26070190 CTGAATCTTCAGATGAGGGGAGG - Intergenic
1172126181 20:32626674-32626696 CTGAATGTTCACAGGAGGGAGGG + Intergenic
1176656183 21:9590713-9590735 CTGAATCCTCAGGTGAGGGGAGG + Intergenic
1178159277 21:29893000-29893022 TTGTATCTTCAGTTGAGGTGGGG - Intronic
1178190076 21:30270021-30270043 CTGGATCTTCATATCAGGAGGGG + Intergenic
1179716237 21:43290199-43290221 TTGAACCTTCAGATCAGGGAGGG + Intergenic
1180984613 22:19897054-19897076 CAGAGCCTTCAGATGTGGGGAGG - Intronic
1183659104 22:39208001-39208023 CTGATTCTTCAGGAGAGGAGAGG + Intergenic
1184975155 22:48056451-48056473 CTGAATTTACAGGTGAGGGTGGG - Intergenic
950075672 3:10185170-10185192 CCGAATCAGCAGATGAGGTGGGG - Intronic
950950322 3:16992040-16992062 TTGAATTTTCAGATGATGGAGGG + Intronic
952033304 3:29170679-29170701 AGGGATTTTCAGATGAGGGGAGG + Intergenic
953669015 3:44947078-44947100 CTGAATCTACAAATGATGGTAGG + Intronic
954955805 3:54517497-54517519 CTGACTCCTCAGTTGTGGGGAGG - Intronic
957507392 3:81140610-81140632 CTGTATCTTCAGATGACAAGTGG - Intergenic
959885808 3:111498054-111498076 CTGATTCTTCAGATGGAAGGTGG - Intronic
960871158 3:122251334-122251356 CTGAACCCTTAGGTGAGGGGAGG - Intronic
963078446 3:141369093-141369115 CGGAATACTCAGGTGAGGGGAGG - Intronic
964330691 3:155599018-155599040 CTGTATCTTCATATGGGGAGGGG - Intronic
966473712 3:180320918-180320940 CTGGATTTTCAGATGACAGGTGG + Intergenic
966809562 3:183831453-183831475 CTGGAGTTTCAGATGAGGGCTGG - Intronic
967768509 3:193309039-193309061 GTGAATCTTTAGATGATGGCTGG - Intronic
967829300 3:193905033-193905055 CTGACTCTTCAGAAAAGGGATGG + Intergenic
969283097 4:6184613-6184635 CTGAATCTACAGGTGAGCGCGGG - Intronic
969588115 4:8106347-8106369 CAGAATCTTCAGAGGAGAGTGGG - Intronic
971443678 4:26718484-26718506 TTGTATCTTCAGATGATGGCAGG - Intronic
971882743 4:32400595-32400617 TTGAATCTTCAGCTGAGGACTGG + Intergenic
974282865 4:59822057-59822079 CTGAGTGTTCAGCTGAAGGGAGG - Intergenic
976319050 4:83690721-83690743 CTGCATCTTCACATGATGGAAGG + Intergenic
979868992 4:125792932-125792954 CAGTATCTACATATGAGGGGCGG - Intergenic
981111009 4:140933460-140933482 TTGGATTTCCAGATGAGGGGTGG + Intronic
981365960 4:143903359-143903381 CTGAATCATCAAATGAGTGCAGG + Intronic
981376067 4:144017171-144017193 CTGAATCATCAAATGAGTGCAGG + Intronic
981386587 4:144138530-144138552 CTGAATCATCAAATGAGTGCAGG + Intronic
983109878 4:163736525-163736547 CTGAAACTGCAGATAAGGGTTGG + Intronic
985450188 4:190057483-190057505 TTGTAGCTTCAGGTGAGGGGAGG - Intergenic
988434771 5:31161188-31161210 CTAAATTTTCAGATGAGAGTAGG + Intergenic
990797998 5:59565828-59565850 CTCAATTCTCATATGAGGGGAGG - Intronic
992743331 5:79795496-79795518 CTGAAACTGCAGAGGAGGTGCGG - Intronic
993613599 5:90084100-90084122 CTGAAAATCCAGATGACGGGAGG + Intergenic
994699307 5:103113401-103113423 CTGTAACTTCACATGAGGGAAGG + Intronic
996124488 5:119708371-119708393 CAGAGTGTTCAGGTGAGGGGTGG + Intergenic
996643231 5:125783459-125783481 CTGAAGGTTCAGATGATTGGTGG + Intergenic
997201068 5:132010671-132010693 CTGAATCTGCACATGGGGGTTGG + Intronic
1001228444 5:169965264-169965286 CTGATTCTTCAGCTGCGGGCTGG + Intronic
1002579394 5:180198561-180198583 CTGCATCTTCACATGGGGGAAGG + Intronic
1003378421 6:5601035-5601057 CTGAATCTTCACATGGCAGGGGG - Intronic
1003665705 6:8109432-8109454 CTGACTCTTCACCTGAAGGGTGG - Intergenic
1007539936 6:42632828-42632850 CTGAATGGTCAGATGAGCTGAGG + Exonic
1007997518 6:46324204-46324226 CTGAACCTTCATATGACAGGTGG + Intronic
1008496577 6:52140037-52140059 CTGGAACTTCAGGGGAGGGGAGG - Intergenic
1011560315 6:88607460-88607482 CTTGATCCTGAGATGAGGGGAGG + Intergenic
1013494993 6:110689369-110689391 CTGATTTTTCAGGTGATGGGTGG - Intronic
1013561137 6:111306223-111306245 CTGATTCCTCAGAAGATGGGGGG + Intronic
1013842009 6:114407700-114407722 CTCATTCTTCAGATCAGGTGTGG - Intergenic
1014249656 6:119102190-119102212 CCCAATCTTCTGATGAGGGATGG - Intronic
1014421041 6:121245733-121245755 CTGAATCTGGGGATGGGGGGAGG - Intronic
1016687480 6:146897971-146897993 CTGAATCTTCATAGGAGTGGAGG - Intergenic
1018483009 6:164210910-164210932 CTGAAGCTTGAGAGGAGGAGGGG + Intergenic
1020158928 7:5752921-5752943 CTGACTCCTCAGATGAGGAAAGG - Exonic
1022325461 7:29326983-29327005 CTTAAACTTCAGATGAATGGAGG + Intronic
1022480324 7:30739373-30739395 CTGAATCTGCAGATCTGAGGGGG - Intronic
1023870786 7:44262065-44262087 GTGAAGCATCAGATGAGGCGAGG + Intronic
1025282866 7:57640892-57640914 CTGAATCTTCAGATGAGGGGAGG + Intergenic
1025301849 7:57824526-57824548 CTGAATCTTCAGATGAGGGGAGG - Intergenic
1028866974 7:95724923-95724945 GTGATTCTTCAGATGAGGGTGGG + Intergenic
1034203475 7:149296498-149296520 CTAAATCTTCAGATGGTGGCGGG - Intronic
1034413770 7:150954676-150954698 CAGAATGTGCAGATGTGGGGTGG + Intronic
1036498547 8:9292992-9293014 TTGAATATTCAGATGATGGTGGG - Intergenic
1039797862 8:40930767-40930789 CTGCATCTTCAGGTGAGAGATGG - Intergenic
1041169738 8:55129392-55129414 CTGAACCTCCTGATGAGGAGAGG + Intronic
1042019805 8:64359686-64359708 TTAAATATTCAGATAAGGGGAGG + Intergenic
1043001672 8:74767467-74767489 CAGACTCTTCAGATGAGGTTAGG - Intronic
1044174099 8:89095659-89095681 AAGAATCTACTGATGAGGGGAGG + Intergenic
1044815633 8:96109412-96109434 CAGAATATTCAGAGGAGGAGGGG - Intergenic
1046446596 8:114328924-114328946 ATGAATTTGGAGATGAGGGGTGG + Intergenic
1048908288 8:139109715-139109737 CAGAATCTTCTGATGAAGAGTGG - Intergenic
1049178816 8:141209939-141209961 CTGGGCCTTCAGATGAGGGTGGG + Intronic
1049305485 8:141900595-141900617 CTGTGTCCTCATATGAGGGGAGG + Intergenic
1049367257 8:142246410-142246432 CTGACTCCTCAGATGGGGGCAGG - Intronic
1049700786 8:144011343-144011365 CTGAAGCATTAGAGGAGGGGTGG + Intronic
1050644667 9:7706411-7706433 CTGATTCAGCAGATGTGGGGTGG - Intergenic
1051011108 9:12415774-12415796 CTGAAACCTTGGATGAGGGGGGG - Intergenic
1052264856 9:26560382-26560404 CTGACTCTTCAGATGAGGTTAGG + Intergenic
1056116085 9:83442630-83442652 CTGAATCCTCAGTGGAGGGGGGG + Intronic
1057013831 9:91632824-91632846 CTGAATCTGCAGAGGAGGCCAGG + Intronic
1057427682 9:94966641-94966663 TTAAATCTTCAGATGAGGAAAGG + Intronic
1059135069 9:111797474-111797496 CTGTTTCTTCACTTGAGGGGAGG - Intergenic
1203633899 Un_KI270750v1:94173-94195 CTGAATCCTCAGGTGAGGGGAGG + Intergenic
1187478942 X:19637701-19637723 GTGAATCTTCAGATCTGAGGTGG + Intronic
1188287903 X:28351039-28351061 CTAAATTTTCAGGTGAGGGCTGG + Intergenic
1190688255 X:52892857-52892879 CAGACTCTTCAGAAGAGGGGAGG + Intronic
1190697727 X:52962935-52962957 CAGACTCTTCAGAAGAGGGGAGG - Intronic
1195068117 X:101255543-101255565 CTGCAACTTCAGATGAGGGAGGG - Intronic
1195461358 X:105129273-105129295 CTGAATCTTCATATGTCAGGAGG + Intronic
1196250871 X:113458740-113458762 CTGTATCTTCAGATAGTGGGAGG + Intergenic
1202597429 Y:26556058-26556080 CTGAATCTGCATAGTAGGGGAGG - Intergenic