ID: 1025303077

View in Genome Browser
Species Human (GRCh38)
Location 7:57835600-57835622
Sequence GACCGCCTGAACCTCCGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025303077_1025303084 15 Left 1025303077 7:57835600-57835622 CCCTGGCGGAGGTTCAGGCGGTC No data
Right 1025303084 7:57835638-57835660 GCTGTGAGTGATGCCTCCTTGGG No data
1025303077_1025303089 25 Left 1025303077 7:57835600-57835622 CCCTGGCGGAGGTTCAGGCGGTC No data
Right 1025303089 7:57835648-57835670 ATGCCTCCTTGGGGCCGGAGGGG No data
1025303077_1025303086 20 Left 1025303077 7:57835600-57835622 CCCTGGCGGAGGTTCAGGCGGTC No data
Right 1025303086 7:57835643-57835665 GAGTGATGCCTCCTTGGGGCCGG No data
1025303077_1025303085 16 Left 1025303077 7:57835600-57835622 CCCTGGCGGAGGTTCAGGCGGTC No data
Right 1025303085 7:57835639-57835661 CTGTGAGTGATGCCTCCTTGGGG No data
1025303077_1025303083 14 Left 1025303077 7:57835600-57835622 CCCTGGCGGAGGTTCAGGCGGTC No data
Right 1025303083 7:57835637-57835659 GGCTGTGAGTGATGCCTCCTTGG No data
1025303077_1025303080 -7 Left 1025303077 7:57835600-57835622 CCCTGGCGGAGGTTCAGGCGGTC No data
Right 1025303080 7:57835616-57835638 GGCGGTCCCGGTGTCGCAAGCGG No data
1025303077_1025303087 23 Left 1025303077 7:57835600-57835622 CCCTGGCGGAGGTTCAGGCGGTC No data
Right 1025303087 7:57835646-57835668 TGATGCCTCCTTGGGGCCGGAGG No data
1025303077_1025303088 24 Left 1025303077 7:57835600-57835622 CCCTGGCGGAGGTTCAGGCGGTC No data
Right 1025303088 7:57835647-57835669 GATGCCTCCTTGGGGCCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025303077 Original CRISPR GACCGCCTGAACCTCCGCCA GGG (reversed) Intergenic
No off target data available for this crispr