ID: 1025304358

View in Genome Browser
Species Human (GRCh38)
Location 7:57842875-57842897
Sequence ATAGAGCCTAGGTGTACGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025304358_1025304366 18 Left 1025304358 7:57842875-57842897 CCTACCGTACACCTAGGCTCTAT No data
Right 1025304366 7:57842916-57842938 CAGGCTGCACACCTGGGCACAGG No data
1025304358_1025304364 11 Left 1025304358 7:57842875-57842897 CCTACCGTACACCTAGGCTCTAT No data
Right 1025304364 7:57842909-57842931 CTGCTCTCAGGCTGCACACCTGG No data
1025304358_1025304362 -1 Left 1025304358 7:57842875-57842897 CCTACCGTACACCTAGGCTCTAT No data
Right 1025304362 7:57842897-57842919 TGGCACAGCCTACTGCTCTCAGG No data
1025304358_1025304365 12 Left 1025304358 7:57842875-57842897 CCTACCGTACACCTAGGCTCTAT No data
Right 1025304365 7:57842910-57842932 TGCTCTCAGGCTGCACACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025304358 Original CRISPR ATAGAGCCTAGGTGTACGGT AGG (reversed) Intergenic