ID: 1025304360

View in Genome Browser
Species Human (GRCh38)
Location 7:57842879-57842901
Sequence TGCCATAGAGCCTAGGTGTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025304360_1025304365 8 Left 1025304360 7:57842879-57842901 CCGTACACCTAGGCTCTATGGCA No data
Right 1025304365 7:57842910-57842932 TGCTCTCAGGCTGCACACCTGGG No data
1025304360_1025304364 7 Left 1025304360 7:57842879-57842901 CCGTACACCTAGGCTCTATGGCA No data
Right 1025304364 7:57842909-57842931 CTGCTCTCAGGCTGCACACCTGG No data
1025304360_1025304362 -5 Left 1025304360 7:57842879-57842901 CCGTACACCTAGGCTCTATGGCA No data
Right 1025304362 7:57842897-57842919 TGGCACAGCCTACTGCTCTCAGG 0: 5
1: 2
2: 7
3: 75
4: 476
1025304360_1025304366 14 Left 1025304360 7:57842879-57842901 CCGTACACCTAGGCTCTATGGCA No data
Right 1025304366 7:57842916-57842938 CAGGCTGCACACCTGGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025304360 Original CRISPR TGCCATAGAGCCTAGGTGTA CGG (reversed) Intergenic
No off target data available for this crispr