ID: 1025304361

View in Genome Browser
Species Human (GRCh38)
Location 7:57842886-57842908
Sequence TAGGCTGTGCCATAGAGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025304361_1025304365 1 Left 1025304361 7:57842886-57842908 CCTAGGCTCTATGGCACAGCCTA No data
Right 1025304365 7:57842910-57842932 TGCTCTCAGGCTGCACACCTGGG No data
1025304361_1025304368 29 Left 1025304361 7:57842886-57842908 CCTAGGCTCTATGGCACAGCCTA No data
Right 1025304368 7:57842938-57842960 GTTATTGCAGTGAATACTGTTGG No data
1025304361_1025304364 0 Left 1025304361 7:57842886-57842908 CCTAGGCTCTATGGCACAGCCTA No data
Right 1025304364 7:57842909-57842931 CTGCTCTCAGGCTGCACACCTGG No data
1025304361_1025304366 7 Left 1025304361 7:57842886-57842908 CCTAGGCTCTATGGCACAGCCTA No data
Right 1025304366 7:57842916-57842938 CAGGCTGCACACCTGGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025304361 Original CRISPR TAGGCTGTGCCATAGAGCCT AGG (reversed) Intergenic
No off target data available for this crispr