ID: 1025304362

View in Genome Browser
Species Human (GRCh38)
Location 7:57842897-57842919
Sequence TGGCACAGCCTACTGCTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 565
Summary {0: 5, 1: 2, 2: 7, 3: 75, 4: 476}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1025304360_1025304362 -5 Left 1025304360 7:57842879-57842901 CCGTACACCTAGGCTCTATGGCA No data
Right 1025304362 7:57842897-57842919 TGGCACAGCCTACTGCTCTCAGG 0: 5
1: 2
2: 7
3: 75
4: 476
1025304358_1025304362 -1 Left 1025304358 7:57842875-57842897 CCTACCGTACACCTAGGCTCTAT No data
Right 1025304362 7:57842897-57842919 TGGCACAGCCTACTGCTCTCAGG 0: 5
1: 2
2: 7
3: 75
4: 476
1025304356_1025304362 12 Left 1025304356 7:57842862-57842884 CCTCAATATTGTACCTACCGTAC No data
Right 1025304362 7:57842897-57842919 TGGCACAGCCTACTGCTCTCAGG 0: 5
1: 2
2: 7
3: 75
4: 476

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1025304362 Original CRISPR TGGCACAGCCTACTGCTCTC AGG Intergenic
900073810 1:795558-795580 TGGCACACCCTCCTGGTGTCTGG - Intergenic
900540728 1:3201465-3201487 GGGCCCAGCCTCCTGCTCACTGG + Intronic
900670396 1:3850047-3850069 TGGCATAGCCTATTGCTCCTGGG - Intronic
900903753 1:5535911-5535933 TGGCACAGGCTTCTGTTCCCTGG - Intergenic
900969246 1:5980364-5980386 TGGCCCAGCCTGCTGCAGTCCGG - Intronic
901697442 1:11019489-11019511 TGGTATAGCCTATTGCTCCCAGG - Intronic
902511412 1:16968937-16968959 TGGCTCAGCCTACTGCCACCTGG - Intronic
902909771 1:19586906-19586928 TGGCAGAGCCTATTGCTCCTAGG + Intergenic
903292366 1:22322462-22322484 TGGCTTAGCCTAGTGCTCCCAGG + Intergenic
903549013 1:24144569-24144591 TGGCACAGCTTCCTGCTTTGGGG + Intergenic
903771441 1:25766908-25766930 TGGCCCAGCCTCCTGCTGCCAGG + Intronic
903982088 1:27196387-27196409 TGGCACAGCCTATTGCTTCTAGG - Intergenic
905125873 1:35715997-35716019 TGGCACAGTCTGCTCCCCTCTGG - Exonic
906093957 1:43207468-43207490 TGGTAGAGCCTACTGCTCCGAGG - Intronic
906809430 1:48811077-48811099 TGGCACAGCATTCCTCTCTCTGG + Intronic
906967589 1:50473694-50473716 TGGCCCTGCCTACTGCTCCAAGG - Intronic
907490305 1:54805169-54805191 TGGTACAACCTACGCCTCTCTGG + Intergenic
908333417 1:63095442-63095464 TGGCACAGCATATTGCTCCTAGG - Intergenic
908680509 1:66655602-66655624 TGGTATAGCCTATTGCTCTTAGG + Intronic
909027499 1:70500093-70500115 TGGGACAGCCTATTGCTCCTAGG - Intergenic
909605275 1:77501477-77501499 TGGTATAGCCTATTGCTCCCAGG + Intronic
909844244 1:80370864-80370886 TGTTATAGCCTACTGCTCCCAGG - Intergenic
909920193 1:81372035-81372057 TGCCATAGCTTACTGGTCTCGGG - Intronic
910702886 1:90095173-90095195 TGGTACAGCCTATTGCTCTTAGG + Intergenic
910858764 1:91722746-91722768 TGGTACAGCCTACTGCTCCTAGG + Intronic
910917069 1:92299997-92300019 TGGTACAGCCTATTGCTCCCAGG + Intronic
911552756 1:99304304-99304326 TGGTACAGCCTATTGCTCCTAGG - Intronic
913380569 1:118205901-118205923 TGGCATAGCCTATTGCTCCTAGG - Intergenic
914993514 1:152518751-152518773 TGGCATAGGCAACTGCTCTAGGG + Intronic
915281740 1:154827470-154827492 TAGCACAGCCTCCTCCTCCCAGG + Intronic
915286332 1:154855559-154855581 TGGTGTAGCCTACTGCTCCCAGG - Intronic
915724574 1:158008314-158008336 GGGCACAGCCTCCTGCCTTCTGG - Intronic
915979785 1:160412977-160412999 TGGTATAGCCTATTGCTCCCAGG - Intronic
916227543 1:162504464-162504486 TTGCACAGTCTATTGCTCTTAGG + Intronic
916702558 1:167312953-167312975 TGGCATAGCCTATTGCTCCTAGG - Intronic
917118757 1:171627568-171627590 TGGCACAGCCAACTACTATGGGG - Intergenic
918021253 1:180694048-180694070 TGGGACAGTCTACTGAGCTCCGG - Intronic
919036418 1:192315446-192315468 TGGCATAGCCTATTGCTCCTAGG + Intergenic
919342808 1:196335366-196335388 TGGTATAGCCTACTGCTATATGG + Intronic
919697474 1:200592819-200592841 TGGCATAGCCTATTGCTCCTAGG + Intronic
920254846 1:204647638-204647660 TTTCACTTCCTACTGCTCTCAGG - Intronic
921141581 1:212312197-212312219 TGGTAGAGCCTACTGCTCCTAGG - Intronic
921185764 1:212667947-212667969 TGACACGGCCAGCTGCTCTCTGG + Intergenic
921447481 1:215263650-215263672 TGGCACAGCCTATTGCTCCTAGG - Intergenic
921617106 1:217282070-217282092 TGGCATAGCCTATTGCTCCTAGG + Intergenic
921744792 1:218727763-218727785 TGGCACAGGCTACTGTCCTAAGG + Intergenic
922183897 1:223257495-223257517 TGGCCAAGCCTGCTACTCTCTGG + Intronic
922269669 1:224020466-224020488 TGGCACACCCTCCTGGTGTCTGG - Intergenic
922399860 1:225241615-225241637 TGGCATAACCTATTGCTCTAAGG + Intronic
922630844 1:227108886-227108908 TGGTATAGCCTATTGCTCCCAGG + Intronic
922934010 1:229410144-229410166 TGGCACAGCCCTCTCCTTTCTGG - Intergenic
923012677 1:230101049-230101071 TGGTACAGCCTACTGCTTCTAGG - Intronic
923114438 1:230922021-230922043 TGACACAGCCGACTGCTCCCAGG + Intronic
923601116 1:235403868-235403890 TGGCATAGCCTATTGCTTTTAGG + Intronic
923893352 1:238239769-238239791 TGGCATAGCCTATTGCTCCTGGG - Intergenic
924304823 1:242676983-242677005 TGGTACAGCCTATTGCTCCTAGG + Intergenic
924712528 1:246542035-246542057 TGGCATAGCCTATTGCTCCAAGG + Intronic
1062919173 10:1266357-1266379 TGGCCAAGCATCCTGCTCTCTGG + Intronic
1063432544 10:6003441-6003463 TGGTAGAGCCTACTGCACTCTGG + Intergenic
1063552754 10:7048703-7048725 TGGTAGAGCCTACTGCACACTGG + Intergenic
1063641636 10:7836348-7836370 TGGCACAACCTCCGGCTCCCTGG + Intronic
1063786104 10:9384991-9385013 TGGCATAGCCTATTGCTCCTGGG + Intergenic
1064099387 10:12450622-12450644 GGACACAGCCTCCTTCTCTCTGG - Intronic
1064445989 10:15393397-15393419 TAGTACAGTCTATTGCTCTCTGG + Intergenic
1065272926 10:24054754-24054776 TGGTATAGCCTACTGCTCATAGG + Intronic
1065783063 10:29188768-29188790 TGATATAGCCTATTGCTCTCAGG - Intergenic
1066007067 10:31155265-31155287 TGGTATAGCCTATTGTTCTCAGG + Intergenic
1067083005 10:43222083-43222105 TGGTACAGCCTATTGCTCCCGGG + Intronic
1067131925 10:43573397-43573419 GGGCACAGCCCACTGCTCTGAGG + Intronic
1067208590 10:44240166-44240188 TGGCATAGCCTATAGCTCCCAGG - Intergenic
1067667992 10:48294887-48294909 TGGTACAGCCTATTGCTCCTAGG - Intergenic
1068820404 10:61370992-61371014 TGGCATAGCCTATTGCTCCTAGG + Intergenic
1070062920 10:73003182-73003204 TGATACAGCCTATTGCTCCCAGG - Intergenic
1071415130 10:85434001-85434023 TGGCACTGTCTACTGCTGCCTGG - Intergenic
1071461217 10:85898093-85898115 TGGCATAGCCTACTGTTCTTAGG + Intronic
1071926858 10:90419269-90419291 TGGTACAGCCTATTGCTCCTAGG - Intergenic
1071950252 10:90696093-90696115 TGGTATAGCCTATTGCTCCCAGG + Intergenic
1072462036 10:95628413-95628435 TGTCACAGACTGCTGATCTCCGG + Exonic
1073562342 10:104507623-104507645 TGGCAGAGCCTAAATCTCTCTGG + Intergenic
1073813697 10:107180883-107180905 TGGCATAGCCTATTGCTCCTAGG + Intergenic
1074083629 10:110188567-110188589 TGGTACAGCCTATTGCTCCTAGG - Intergenic
1074752942 10:116604436-116604458 TGGTACAGCCTATTGCTCCTAGG - Intronic
1074997271 10:118768515-118768537 TGGCATAGCCTGTTGCTCCCAGG + Intergenic
1076304315 10:129453430-129453452 TGGTATAGCCTATTGCTCCCAGG - Intergenic
1076910983 10:133389404-133389426 GGTCCCAGCCCACTGCTCTCGGG + Intronic
1077290209 11:1785871-1785893 CGGTACAGCCTACTGCTCCTAGG - Intergenic
1077419186 11:2441609-2441631 TGCCACAGCCTGCTGCTCTGGGG - Intergenic
1077757744 11:5053276-5053298 TGGGAAAGCCTATTGCTCTTAGG - Intergenic
1077863633 11:6204987-6205009 TGGTATAGCCTATTGCTCTTGGG + Intergenic
1077871588 11:6266882-6266904 CGGTATAGCCTACTGCTCCCAGG + Intronic
1078933583 11:15932598-15932620 TGGCATAGCCTATTGCTCCTAGG - Intergenic
1080855425 11:36107693-36107715 TGGTACAGCCTGCTGCTCCTAGG - Intronic
1081666859 11:44921629-44921651 TGGCCCAGGCTCCTTCTCTCTGG - Intronic
1081839601 11:46188267-46188289 TGGTACAGCCTATTGCTCCTAGG + Intergenic
1082846817 11:57732957-57732979 TGGCACAACCTGTTGCTCCCAGG + Intronic
1085511501 11:77090569-77090591 GGGCTCAGCCTCCTCCTCTCTGG + Intronic
1085833088 11:79923052-79923074 TGGTACAGCCTACTGCTCCTAGG - Intergenic
1086409848 11:86533929-86533951 TGGCATAGCCTATTGCTCCTAGG + Intronic
1087003548 11:93445473-93445495 TGGCATAGCCTATTGCTCCTAGG + Intergenic
1088851825 11:113710459-113710481 TGGCATAGTCTACTGCTCTGAGG - Intergenic
1089041842 11:115459087-115459109 TGGCACAGTGTACTCTTCTCTGG - Intronic
1089150809 11:116362739-116362761 TGGGTCTGTCTACTGCTCTCTGG + Intergenic
1090066948 11:123511317-123511339 TGGCCCCGCCCACTGCTCGCCGG + Intergenic
1090652318 11:128817969-128817991 TGGTACAGCCTATTGCTCCGAGG + Intergenic
1091540534 12:1457143-1457165 TGGTACAGCCTATTGCTCCTAGG - Intronic
1091700712 12:2659381-2659403 TGGTACAGCCTACTGCTCCTAGG - Intronic
1092150064 12:6241801-6241823 CAGGACAGCCTGCTGCTCTCGGG + Intergenic
1092498349 12:9020949-9020971 TGGGACAGCCTATTGCTCTTAGG + Intergenic
1092751106 12:11719896-11719918 GGGCACAGGCTTCTGCTGTCTGG + Intronic
1093415060 12:18910237-18910259 TGGTATAGCCTACTGCTCCCAGG + Intergenic
1093598292 12:20988926-20988948 TGGCATAGCCTATTGCTTTGAGG + Intergenic
1093774276 12:23053997-23054019 TGGCACTGCTCACAGCTCTCCGG - Intergenic
1094458146 12:30662037-30662059 TGGCATAGCCTATTGCTCCAAGG + Intronic
1096182858 12:49560087-49560109 TGGCCCAGCCTCCTTCTCTGGGG + Intronic
1096216357 12:49799800-49799822 CTGCACAGCTTGCTGCTCTCTGG + Intronic
1096240429 12:49956891-49956913 TAGAGCAGCCTGCTGCTCTCAGG + Exonic
1096443707 12:51668987-51669009 TGGTATAGCCTATTGCTCCCAGG + Intronic
1096948558 12:55438732-55438754 TGGCATAGCCTATTGCTCCTAGG - Intergenic
1096965511 12:55624075-55624097 TGGTACAGCCTATTGCTCCCAGG - Intergenic
1097140242 12:56896591-56896613 GGGCACCCCCTCCTGCTCTCTGG + Intergenic
1097462390 12:59878093-59878115 TGGTGCAGCCTACTGCTCCTAGG + Intergenic
1098355744 12:69610891-69610913 TGGCTCAGCTGACTGCTCTGGGG + Exonic
1098890367 12:76004341-76004363 TGGTACAGCCTATTGCTCTTAGG - Intergenic
1099352065 12:81584631-81584653 TGGCATAGCTTACTGCTCCTAGG + Intronic
1100320167 12:93483415-93483437 TGGTATAGCCTATTGCTCCCAGG + Intronic
1100677446 12:96882831-96882853 TGGTATAGCCTATTGCTCTGAGG + Intergenic
1100703488 12:97175051-97175073 TGATATAGCCTACTGCTCCCAGG + Intergenic
1100709666 12:97242311-97242333 TGACACAGCCGACTGCTCTAAGG + Intergenic
1101406236 12:104431712-104431734 TGATACAGCCTATTGCTCCCAGG + Intergenic
1101473130 12:105018085-105018107 TGATACAGCCTATTGCTCCCAGG - Intronic
1101805786 12:108062397-108062419 GGGCAATGCCTGCTGCTCTCAGG + Intergenic
1101843852 12:108346267-108346289 GGGCAAGGCCCACTGCTCTCTGG + Intergenic
1102472948 12:113169857-113169879 TGGCACAGCCTACTCCTTGGTGG - Exonic
1102973636 12:117190517-117190539 TGGCCCCGCCTACTGGTCTTGGG + Intronic
1104992134 12:132631731-132631753 TGGTCCAGCCTACTGGTCTCCGG + Intronic
1106002348 13:25736102-25736124 TGGTACAGCCTATTGCTCCTAGG - Intronic
1106906201 13:34412153-34412175 TGGAACAGCCTATTGCTCCAAGG + Intergenic
1107300737 13:38963282-38963304 TGGCATAGCCTATTGCTCCTAGG + Intergenic
1108090631 13:46846027-46846049 TGGGACAGCCTAATGCTCCTAGG - Intronic
1108180020 13:47831537-47831559 TGGTACAGCCTATTGCTCCTAGG + Intergenic
1108489382 13:50965273-50965295 TGGTACAGCCTACTGCTCCTGGG - Intronic
1108901860 13:55420662-55420684 TGGCATAGCCTATTGCCCTTAGG + Intergenic
1109084085 13:57948043-57948065 TGGCATAGCCTATTGCTCCTGGG - Intergenic
1109506023 13:63304584-63304606 TGGCACAGCCTATTGTTCCTAGG - Intergenic
1109689833 13:65871724-65871746 TGGTATAGCCTATTGCTCCCAGG - Intergenic
1109844190 13:67962990-67963012 TGGTACAGCCTATTGCTCCTAGG - Intergenic
1110240598 13:73262158-73262180 TGGCACAGCCTATTGCTCCTAGG + Intergenic
1110352379 13:74523735-74523757 TGCTACAGCCTATTGCTCTTAGG + Intergenic
1110582219 13:77143776-77143798 TGGTACAGCCTATTGGTCTTAGG + Intronic
1110785124 13:79515095-79515117 TGGTATAGCCTACTGCTCCTAGG + Intronic
1111688426 13:91529783-91529805 TTCCACAGCCTAATGCTCCCAGG - Intronic
1111804670 13:93024641-93024663 TGGCATGCACTACTGCTCTCAGG - Intergenic
1112315607 13:98359736-98359758 AGGTACAGCCTACTGCTGTCAGG - Intronic
1115165531 14:30444827-30444849 TTAAACAGCCTTCTGCTCTCTGG - Intergenic
1115286219 14:31715485-31715507 TGGCATAGCCTATTGCTCCTAGG + Intronic
1115807839 14:37072316-37072338 TGGCACAGCCTGAGGCTCTGTGG - Intronic
1116070754 14:40041871-40041893 TGGCACAGCCTTTTGCTCCTAGG - Intergenic
1116798280 14:49414933-49414955 TGGTACAGTCTATTGCTCCCAGG - Intergenic
1118507960 14:66435900-66435922 TGGTATAGCCTACTGCTTCCAGG - Intergenic
1118524872 14:66628350-66628372 TGGCATAGGCTATTGCTGTCAGG + Intronic
1118561926 14:67094937-67094959 TGGTATAGCCTATTGCTCTTGGG - Intronic
1118815984 14:69314336-69314358 TGGCAGTTCTTACTGCTCTCTGG - Intronic
1118835148 14:69472701-69472723 TGGTACAGCCTATTGCTCCTAGG - Intergenic
1120812461 14:88818198-88818220 TGTCTCAGCCTATTGCACTCAGG + Intergenic
1121855387 14:97264704-97264726 TGGTACAGCCCATTGCTCTTAGG - Intergenic
1122188653 14:100022243-100022265 TGGCCCTTCCTTCTGCTCTCAGG - Intronic
1122303601 14:100747127-100747149 TGGTACAGCCTACTGCACACCGG - Intergenic
1122383421 14:101327028-101327050 TGGCAGTGCGTCCTGCTCTCAGG + Intergenic
1122615206 14:103012899-103012921 TGGCACAACCTACTGCTCCTGGG - Intronic
1122987198 14:105217948-105217970 TGGGCCAGCCTGGTGCTCTCTGG + Intronic
1123978211 15:25573056-25573078 TGGTACAGCCTACTGCTCCTAGG - Intergenic
1124407764 15:29407167-29407189 TGGTACGGCCTACTGCTCCCAGG + Intronic
1124449313 15:29771276-29771298 TGGCATAGCCTATTGCTCCTCGG + Intronic
1124506964 15:30286044-30286066 TGGTACAGCCTACTGCTCCTGGG - Intergenic
1124623465 15:31293889-31293911 TGGTACAGCCTATTGCTCCTAGG + Intergenic
1124736593 15:32252617-32252639 TGGTACAGCCTACTGCTCCTGGG + Intergenic
1124982295 15:34577679-34577701 GGGTACAGCCTACTGCTCCTAGG + Intronic
1125193974 15:37025344-37025366 TAGCACAGCCTTTTGCTCCCTGG - Intronic
1125322569 15:38503958-38503980 TGGTATAGCCTACTGCTCCTAGG + Intronic
1125781347 15:42271613-42271635 TGGTACAGCCTATTGCTCCTAGG - Intronic
1125845218 15:42845843-42845865 TGGTACAGCCTATTGCTCCTAGG + Intronic
1125990572 15:44102881-44102903 AGTCACAGCCTTCTGCTCTGAGG + Intronic
1125990708 15:44104672-44104694 TGGTATAGCCTATTGCTCTTAGG - Intronic
1126276292 15:46885772-46885794 TGGCATAGCCTATTGCTCCCAGG - Intergenic
1126555746 15:49985698-49985720 TGGAAAAACTTACTGCTCTCTGG - Intronic
1127076857 15:55335110-55335132 TGGTATAGCCTACTGCTCCTAGG - Intronic
1127898033 15:63320152-63320174 TGGTACAGCCTATTGCTCCTAGG - Intergenic
1128584988 15:68840617-68840639 TGGAACAACCTATTCCTCTCTGG - Intronic
1128802219 15:70504195-70504217 GGGCCCAGCCTGCAGCTCTCAGG + Intergenic
1129627570 15:77218724-77218746 TGGCACACACCACTGCACTCAGG + Intronic
1132079617 15:98852896-98852918 GAGCACAGCATACTGTTCTCAGG + Intronic
1132350371 15:101136013-101136035 TGGGACAGCCTGCTGCTCCTGGG + Intergenic
1133413010 16:5583954-5583976 TGGCACAGCCTTGAGCTCCCTGG - Intergenic
1135720397 16:24812650-24812672 TGGCCTAGCCTACTGCTCCTAGG - Intronic
1137345860 16:47658655-47658677 TGGCACAGCCTATTGCTCTTAGG - Intronic
1139199910 16:64964274-64964296 TGGCACAGCCTATTGCTCCTAGG + Intronic
1139476903 16:67207350-67207372 CGCCACAGGCTCCTGCTCTCTGG - Exonic
1139771961 16:69284993-69285015 TGGTACTGCCTATTGCTCTTAGG - Intronic
1141951558 16:87343135-87343157 TGCCACTGCCTCCTGCTCTTGGG - Intronic
1141986737 16:87585206-87585228 TTGCACCCCCTCCTGCTCTCAGG - Intergenic
1142384683 16:89755960-89755982 TGGCACGGCCCACCGCTCCCAGG + Intronic
1143136949 17:4717444-4717466 TGACACTGCCTCCTGCTCTGTGG + Intronic
1143700149 17:8652751-8652773 TGGTATAGCCTACTGCTCCTAGG - Intergenic
1144730168 17:17521446-17521468 AGGCACAGCCCACTGCACTTGGG - Intronic
1145416576 17:22718263-22718285 TGGCACAGCCTACTGCTCTCAGG - Intergenic
1145820855 17:27833781-27833803 TGGTACAGCCTATTGCTCCTAGG + Intronic
1147693185 17:42331028-42331050 TGGCAGAGCCTACTGGTCGTAGG - Intronic
1149582518 17:57761174-57761196 TGGCCCATCCTTCAGCTCTCGGG + Intergenic
1149747619 17:59114416-59114438 TGGTATAGCCTACTGCTCCTGGG + Intronic
1150644432 17:66969200-66969222 TGGCACAAGCTGCTGCCCTCTGG - Intronic
1151704399 17:75758963-75758985 TGGGACAGCCTGCTGGTCCCTGG - Intronic
1151915349 17:77114007-77114029 AGGCACAGCCTTCTGGTCCCAGG + Intronic
1153027170 18:682274-682296 TGGCATGGCCTATTGCTCCCAGG + Intronic
1153069810 18:1092187-1092209 TGGAACAGCCTACTACTGTCTGG - Intergenic
1153904521 18:9649575-9649597 TGGCAGAGCCTACTACACACTGG - Intergenic
1155822949 18:30401365-30401387 TGGTGTAGCCTACTGCTCCCAGG - Intergenic
1156498097 18:37538998-37539020 TGCCCCACCCTGCTGCTCTCAGG + Intronic
1156920623 18:42518282-42518304 TGGTACAGCCTATTGCTCCTAGG - Intergenic
1156974506 18:43202125-43202147 TGGTATAGCCTATTGCTCTGAGG + Intergenic
1157532906 18:48437135-48437157 TGGCACAGCCTACTACACTGAGG + Intergenic
1157707090 18:49816190-49816212 TGGTACAGCCTATTGCTCCTAGG + Intronic
1158255923 18:55548680-55548702 TGGCATAGCCTATTGCTCCAAGG + Intronic
1159789438 18:72759556-72759578 TGTCAGAGTCTTCTGCTCTCTGG - Intronic
1161340260 19:3737893-3737915 AGACACAGCCACCTGCTCTCAGG - Intronic
1161340276 19:3738022-3738044 AGACACAGCCACCTGCTCTCAGG - Intronic
1161340281 19:3738069-3738091 GGACACAGCCATCTGCTCTCCGG - Intronic
1161526229 19:4757510-4757532 TGGTAGAGCCTAATGCTCCCAGG + Intergenic
1161718086 19:5888464-5888486 TGGTACTGTCTACTGCTCCCAGG + Intronic
1163167820 19:15509606-15509628 AGGCACAGGCTTCTTCTCTCTGG - Intronic
1164528100 19:29026601-29026623 TGCCGCAGCCTGCTGCTCCCGGG + Intergenic
1165648340 19:37464613-37464635 TGGCACAGCCTATTGTTCCCAGG - Intronic
1166270188 19:41708774-41708796 TGGCAGAGGCTCCTGCTCACAGG + Exonic
1166423232 19:42654242-42654264 TGGCAGAGGCTCCTGCTCACAGG + Intronic
925838435 2:7967860-7967882 TGGCATAGCCTGTTGCTCTTGGG - Intergenic
926433622 2:12816288-12816310 TGGCACAGCCACCTGGCCTCAGG + Intergenic
927098076 2:19763390-19763412 TGGCACAGCCCCATGCTCACTGG - Intergenic
927924497 2:27001251-27001273 TGGCATAGCCTATTGCTCCTAGG + Intronic
928281398 2:29949510-29949532 TGGCTCAGCCTAGTGATGTCAGG + Intergenic
928963046 2:36949182-36949204 TGGCATAGCCTATTGCTCCTAGG - Intronic
930668196 2:54120672-54120694 TGGCCCAGCAGACTGCGCTCAGG + Intronic
930922491 2:56774103-56774125 TGATACAGGCTGCTGCTCTCAGG + Intergenic
931193275 2:60025759-60025781 TGGTACAGCCTACTACACACCGG + Intergenic
931472494 2:62553144-62553166 TGGCACACCTTCCTGCTTTCAGG + Intergenic
931631252 2:64302384-64302406 TGGGATAGCCTATTGCTCCCAGG + Intergenic
931898439 2:66760836-66760858 TGGCATAGCCTATTGCTCCTAGG - Intergenic
931937568 2:67215260-67215282 TCGCACAGGCTCCAGCTCTCAGG + Intergenic
932587214 2:73038158-73038180 AGGTAGAGCCTACTGCTCCCTGG + Intronic
933424610 2:82094084-82094106 TGACACAGCCTATTGCTCCTAGG - Intergenic
934112402 2:88756130-88756152 TGGCACCGCCTGCTGCCTTCTGG + Intergenic
934321176 2:91973520-91973542 TGGCATAGCCTATTGCTCCTAGG - Intergenic
935611880 2:105034202-105034224 TGGTACAGCCTATTGTTCCCAGG + Intergenic
936451978 2:112640622-112640644 TGGCACAGTCTCCTGTGCTCTGG + Intergenic
937631243 2:124103636-124103658 TGGCACAGCTTATTGCTCCTAGG - Intronic
938003860 2:127771277-127771299 CGGTACAGCCTAATGCTCTTAGG + Intronic
938113318 2:128585777-128585799 TGGTATAGCCTATTGCTCACAGG + Intergenic
938397203 2:130960430-130960452 TGGTAGAGCCTACTGCTCCTAGG - Intronic
938446799 2:131386920-131386942 AGCCACACCCTACTGCCCTCAGG + Intergenic
939520092 2:143219280-143219302 TGGCATAGCCTATTGCTCCTAGG - Intronic
939908888 2:147954416-147954438 TGGCATAGCCTATTGCTCCTAGG + Intronic
940479537 2:154211218-154211240 TGGTATAGCCTATTGCTCCCAGG + Intronic
940717387 2:157242542-157242564 TGGCATAGCCTATTGCTCCTAGG + Intergenic
940872021 2:158868257-158868279 TGGCACACCCGACTGCTGTGGGG - Intergenic
940897894 2:159098319-159098341 TGGCATAGCCTATTGCTCCTAGG - Intronic
940910868 2:159208870-159208892 TGGCACAGCCTATTGCTCCCAGG + Intronic
941074948 2:160996470-160996492 TGGCACAACCTATTGCTCCTAGG - Intergenic
942571241 2:177316716-177316738 TGGTATAGCCTATTGCTCCCAGG - Intronic
942596606 2:177597401-177597423 GGGCACTGCATTCTGCTCTCTGG + Intergenic
942602531 2:177656342-177656364 TGGGATAGCCTATTGCTCCCAGG - Intronic
942894716 2:181038299-181038321 TGGTATAGCCTATTGCTCCCAGG - Intronic
943667138 2:190621261-190621283 TGGCATAGCCTATTGCTCCTAGG + Intergenic
948703445 2:239775081-239775103 AGGCACAGCCTCCTGCCCTCTGG - Intronic
1169871257 20:10250904-10250926 TGGTATAGCCTATTGCTCCCAGG - Intronic
1170420913 20:16192264-16192286 TAGTACAGCCTACTGCTCCTAGG + Intergenic
1171039269 20:21744721-21744743 TGGTATAGCCTATTGCTCTGAGG + Intergenic
1171316609 20:24200995-24201017 TGGTAGAGCCTATTGCTCCCAGG + Intergenic
1171519888 20:25767651-25767673 TGGCACAGCCTACTGCTCTCAGG - Intronic
1171557031 20:26088842-26088864 TGGCACAGCCTACTGCTCTCAGG + Intergenic
1172869842 20:38129247-38129269 AGGCACTGCCTTCTCCTCTCTGG - Exonic
1173024033 20:39291173-39291195 TGGAACAGCCTACAGAACTCAGG - Intergenic
1174490972 20:50895278-50895300 TGGCATAGCTTATTGCTCTTAGG + Intronic
1174927117 20:54772636-54772658 TGGCACAGCCTACAACAGTCAGG - Intergenic
1174943308 20:54956263-54956285 TGGTACAGCCTACTGCTCTTAGG + Intergenic
1175167037 20:57051470-57051492 TGGTACGGCCTACTGCTCCCAGG + Intergenic
1176285892 21:5019456-5019478 TGTCACAGCCTGCTGCTCCAGGG - Intergenic
1176654026 21:9573940-9573962 TGGCACAGCCTACCGCTCTCAGG - Intergenic
1176674979 21:9769277-9769299 TGGTACAGCCTGTTGCTCCCGGG + Intergenic
1178143491 21:29711348-29711370 TGGTATAGCCTACTGCTCCTAGG - Intronic
1179000286 21:37451544-37451566 CGGTAGAGCCTACTGCTCTTAGG - Intronic
1179539123 21:42072791-42072813 TGGGAAAGCCTAATGCTCTGGGG - Intronic
1179871289 21:44244019-44244041 TGTCACAGCCTGCTGCTCCAGGG + Intergenic
1180124386 21:45779004-45779026 AGGCACAGCCTACTGCCACCAGG - Intronic
1180129049 21:45814052-45814074 TGGTACAGCCTATTGGTCTTAGG + Intronic
1180607239 22:17067966-17067988 CAGCATAGCCTACTGCTCCCCGG - Intergenic
1180662865 22:17484038-17484060 TGGCATAGCCCACTGCTCCTAGG - Intronic
1181480670 22:23197234-23197256 TGGCACAGCCTATTGCTCCTAGG - Intronic
1181930021 22:26393415-26393437 TGGCATAGCCTATTGCTCCTAGG - Intergenic
1182521781 22:30888842-30888864 TGGCACAGCCTATAGCTCCTGGG + Intronic
1183112590 22:35661527-35661549 TGGGAGAGCCTATTGCTCCCAGG + Exonic
1183250550 22:36727130-36727152 TGGGAAAGCCAACTGCTCCCAGG - Intergenic
1184620317 22:45671865-45671887 GGGCTCAGCCTAGAGCTCTCCGG + Exonic
1184659516 22:45959494-45959516 TAGCACAGCCGACTTCTCCCAGG - Intronic
1185135498 22:49069479-49069501 TGGCACAGCCTGGTGCTCCCAGG + Intergenic
949103671 3:177765-177787 TGGTACAGCCTATTGCTCCTAGG + Intergenic
950206165 3:11082789-11082811 TGGAACAGCCTCCTGCTCTGGGG - Intergenic
951303453 3:21027435-21027457 TGGCATAGCCTATTGCTCCTAGG + Intergenic
951622629 3:24622266-24622288 TGGTATAGCCTACTGCTCCTAGG - Intergenic
952114321 3:30161013-30161035 TGGTACAGCCTATTGCTCCCGGG - Intergenic
953063523 3:39448399-39448421 TGACATAGCCTACTGCTCCTAGG + Intergenic
953066592 3:39478348-39478370 TGGTATAGCCTATTGCTCCCAGG - Intronic
953880907 3:46690867-46690889 TGGCAGAGCCTACAACTCCCAGG + Intronic
953925869 3:46982148-46982170 TTGCATAGCCTACTCCTCCCTGG - Intronic
954679383 3:52334150-52334172 TGGTACAGCCTAGTGCTCCTAGG + Intronic
954933932 3:54309539-54309561 TGGCAGAGCCAGCTGCTCTCGGG + Intronic
955737056 3:62050371-62050393 TGGTATAGCCTACTGCTCCTAGG - Intronic
956010582 3:64827087-64827109 TGGAATAGCCTATTGCTCCCAGG - Intergenic
956361080 3:68448081-68448103 TCACACACCCTACTGCTCTCTGG - Intronic
957137084 3:76302696-76302718 TGACACAGCCTATTGCTCCTAGG - Intronic
957462857 3:80544818-80544840 TGGCACAGCCTATTGTTCCTAGG + Intergenic
958186561 3:90128168-90128190 TGGTATAGCCCACTGCTCCCAGG - Intergenic
958730514 3:97955823-97955845 TGGTACAGCCTACTGCTCCTAGG + Intronic
959152758 3:102627589-102627611 TGGCATAGCCTATTGCTCCTGGG + Intergenic
959642057 3:108651534-108651556 TGGCATAACCTACTGCTCCTAGG - Intronic
960567474 3:119148774-119148796 TGGCATAGCCTATTGCTCCTAGG + Intronic
960601810 3:119466554-119466576 TGGCATAGCCTATTGCTCCTAGG - Intronic
960608933 3:119536931-119536953 TGGTACAGCCCAGTGCTCTGAGG - Intronic
960854994 3:122093489-122093511 TGGCACAGCCTATTGCTCCTAGG + Intronic
961041280 3:123680168-123680190 TTCCACAGCCTTCTGTTCTCAGG + Intronic
962129236 3:132654930-132654952 TGGTACAGCCTGCTGCTCCTAGG + Intronic
962496559 3:135945892-135945914 TGGTACAGCCTATTGCTTTTAGG - Intergenic
962871215 3:139494508-139494530 TGGCGCATCCTCCTCCTCTCTGG + Intergenic
962914735 3:139890270-139890292 TGGCATAGCCTATTGCTCCTAGG - Intergenic
962982511 3:140503439-140503461 TGGTACAGCCTATTGCTCCTAGG - Intronic
963216193 3:142751421-142751443 TGGTATAGCCTACTGCTCCTAGG - Intronic
963973218 3:151452334-151452356 TGGTAAAGCCTACTGCTCCTAGG + Intronic
964302495 3:155304636-155304658 TGGCCCAGCACAGTGCTCTCAGG + Intergenic
964981939 3:162694586-162694608 TTGTACAGCCTATTGCTCCCAGG + Intergenic
965674325 3:171179046-171179068 TGCCCCAGCCACCTGCTCTCAGG - Intronic
966161331 3:176972012-176972034 TGGAATAGCCTACTGCTCCTAGG + Intergenic
967690317 3:192466089-192466111 TGGCATAGCCTACTGCTTCTAGG + Intronic
967795145 3:193591924-193591946 TGGTACAGCAAATTGCTCTCTGG + Intronic
967848215 3:194061323-194061345 TTGTACAGCCTATTGCTCCCAGG - Intergenic
969785476 4:9453979-9454001 TGGCACAGCCGACTGCCGTGGGG - Intergenic
969966404 4:11001297-11001319 TGGTACAGCCGACTGCTCCTAGG + Intergenic
970186382 4:13458797-13458819 TGGCACAGCCTATTGCTCCTAGG - Intronic
970845813 4:20535973-20535995 TGGCACAGCCTATTGCTCCTGGG + Intronic
970881053 4:20931474-20931496 TGGTATAGCCTATTGCTCCCAGG + Intronic
971059221 4:22948466-22948488 TGGCACAGCCTATTGCTTCTAGG + Intergenic
971356715 4:25901655-25901677 TGTCACAGCTAAATGCTCTCAGG - Intronic
972590778 4:40484483-40484505 TGGTTCATCCTACTGCTTTCAGG - Intronic
972655678 4:41061429-41061451 TGGCAGAGCCTAGTGTTCCCAGG + Intronic
973725274 4:53769509-53769531 TGGAACAGCCTCTTGCTCCCAGG - Intronic
974372396 4:61034370-61034392 GGGCATAGACTAATGCTCTCTGG + Intergenic
975278535 4:72532707-72532729 TGGCACAACATATTGCTCCCAGG + Intronic
975601843 4:76108780-76108802 TGGTATAGCCTACTGCTCCTAGG + Intronic
976362754 4:84199272-84199294 TAGCACAGCCTATTGGTCTCAGG + Intergenic
976680384 4:87749382-87749404 TGGTATAGCCTATTGCTCCCAGG + Intergenic
976991751 4:91376319-91376341 TGGCATAGCCTATTGCTCTTAGG + Intronic
977263933 4:94832243-94832265 TGGTATAGCCTATTGCTCCCAGG - Intronic
977463304 4:97353412-97353434 TGGTATAGCCTACTGCTCCTAGG - Intronic
977658414 4:99552434-99552456 TGGCATAGCCTATTGCTCCTAGG - Intronic
978295310 4:107198113-107198135 TGGTATAGCCTACTGCTCCTAGG + Intronic
978394570 4:108264822-108264844 TGGTATAGCCTATTGCTCCCAGG - Intergenic
978676278 4:111321959-111321981 TGGTACAGCAAACTGCTCTCTGG + Intergenic
979718083 4:123865987-123866009 TGGTACAGCCTATTGCTCCTAGG - Intergenic
979808016 4:124999306-124999328 TGGTATAGCCTACTGCTCGTAGG + Intergenic
980135578 4:128855654-128855676 CGGCACAGCCAGCTGCCCTCTGG - Exonic
981166546 4:141565675-141565697 TGGCATAGCCTATTGCTCCTAGG + Intergenic
982251920 4:153415919-153415941 TGGTATAGCCTACTGCTCCTAGG + Intergenic
983091050 4:163503085-163503107 TGGCATAGCCTATTGCTCCTAGG - Intronic
983282150 4:165694602-165694624 TGGTATAGCCTATTGCTCCCAGG - Intergenic
983482478 4:168291932-168291954 TGTCACACCCTGCTGTTCTCTGG - Intronic
984046681 4:174809249-174809271 TGGTACAGCCTATGGCTCCCAGG - Intronic
984114676 4:175664916-175664938 TGGTATAGCCTATTGTTCTCAGG + Intronic
984544493 4:181085020-181085042 TGGCACATCCTACTGCAATCAGG - Intergenic
984749720 4:183260607-183260629 TGGTATAGCCTATTGCTCCCAGG - Intronic
985256780 4:188077909-188077931 TGGTACAGCCTATTGCTCCTAGG + Intergenic
985400574 4:189589418-189589440 TGGTACAGCCTGTTGCTCCCGGG - Intergenic
985579748 5:690366-690388 TGGCCCAGCCTGGTGCCCTCAGG - Intronic
985594594 5:782425-782447 TGGCCCAGCCTGGTGCCCTCAGG - Intergenic
985867576 5:2526744-2526766 TGGTACACCCTATTGCTCCCAGG + Intergenic
985941063 5:3136580-3136602 TGGCATAGCCTATTGCTCCTGGG + Intergenic
986024253 5:3835430-3835452 TGGCATAGCCTATTGCTCCTGGG + Intergenic
987632827 5:20497490-20497512 TAGTACAGCCTATTGCTCTTAGG - Intronic
987844823 5:23269706-23269728 TGGTACAGCCTATTGCTCCTAGG - Intergenic
987940360 5:24527569-24527591 TGGTACAGCCTACTGCTCCTAGG + Intronic
988387762 5:30588784-30588806 TGGCATAGCGTACTGCTCCTAGG + Intergenic
988566069 5:32320753-32320775 TGCCACAGCCTGCTGCCCACTGG - Intergenic
988647760 5:33113298-33113320 TGGTACAGCCTATTGCTCTTAGG + Intergenic
988772839 5:34449349-34449371 TGATACAGCCTATTGCTCCCGGG + Intergenic
988791764 5:34614982-34615004 TGGTATAGCCTATTGCTCCCAGG - Intergenic
988831552 5:34992360-34992382 TGGTATAGCCTACTGCTCCCAGG - Intergenic
988842200 5:35093913-35093935 TGACATAGCCTATTGCTCCCAGG - Intronic
989553394 5:42762070-42762092 TGGTATAGCCTACTGCTCCTAGG + Intronic
990520619 5:56576201-56576223 TGGAACAGCCTATTGCTCCTAGG - Intronic
991080157 5:62589706-62589728 TGGCACAGACTTCTCCTCTAGGG - Intronic
991939090 5:71832883-71832905 TGCTACAGCCTACTGCTCCTAGG - Intergenic
992449898 5:76866693-76866715 TGGCATAGCCTATTGCTCCTAGG - Intronic
993296961 5:86153153-86153175 TAACTCAGCCTGCTGCTCTCAGG + Intergenic
993673762 5:90793868-90793890 TTGCACAGCTTCCTTCTCTCTGG + Intronic
994002245 5:94793877-94793899 TGGCACAGAGTGCTGCTCTTAGG + Intronic
994337227 5:98581581-98581603 AGAAACTGCCTACTGCTCTCAGG + Intergenic
995392235 5:111652298-111652320 TGGTACAGCCTATTGCTCCTAGG + Intergenic
995517517 5:112968844-112968866 TAGTACAGCCTATTGCTCCCAGG - Intergenic
998920446 5:147062222-147062244 TGGTACAGCCTATTGCTCCTAGG - Intronic
999437714 5:151576889-151576911 TGGTACAGCCTATTGCTCCTAGG + Intergenic
1002301840 5:178261847-178261869 CAGCCCAGCCTCCTGCTCTCTGG - Intronic
1002341745 5:178521006-178521028 TGGCAGAGCCTACTACACACTGG + Intronic
1002582835 5:180220593-180220615 TGGCAAAGCCTATTGCTCCTGGG + Intergenic
1002620453 5:180484448-180484470 TAGGTCAGCCTCCTGCTCTCCGG + Intergenic
1003458084 6:6302383-6302405 TGGCAGAGCCTACTGCTGTTAGG + Intronic
1003809006 6:9758892-9758914 TGACACAGGCTGCTGCTCTTTGG - Intronic
1004290168 6:14359501-14359523 TGGTAGAGCCTATTGCTCCCAGG - Intergenic
1004363108 6:14988411-14988433 TGGTGCAGCCTATTGCTCCCAGG + Intergenic
1004497547 6:16179265-16179287 TGGTACAGCCTACCGCTCCCAGG + Intergenic
1004649643 6:17596875-17596897 TGGTATAGCCTATTGCTCCCAGG - Intergenic
1004948776 6:20644968-20644990 TGGTATAGCCTATTGCTCCCAGG + Intronic
1005077351 6:21921338-21921360 TGGTACAACCTATTGCTCTTGGG + Intergenic
1005093991 6:22091690-22091712 TGGCAGGGCCTATTGCTCCCAGG + Intergenic
1005421873 6:25659767-25659789 TGGCACAACATGTTGCTCTCAGG - Intronic
1006526218 6:34607690-34607712 TGGTATAGCCTATTGCTCTTAGG + Intronic
1006670738 6:35728395-35728417 GGGCAGAGCCTGCTGCGCTCAGG - Intronic
1007254532 6:40519577-40519599 TGGCCCAGCCTGCTGGTCTCAGG + Intronic
1007918164 6:45580799-45580821 TGGCATAGCCTATTGCTCCTAGG - Intronic
1009880063 6:69555670-69555692 TGGTATAGCCTATTGCTCTTAGG - Intergenic
1010208784 6:73346671-73346693 TGGCAGAGCCTACTGACATCTGG - Intergenic
1010392316 6:75351649-75351671 TGGCACAGCCTGTTACTCTTAGG - Intronic
1010487774 6:76436089-76436111 TGGCATAGCCTAATGCTCCCAGG + Intergenic
1010805357 6:80229323-80229345 TGTCACTGACCACTGCTCTCAGG + Intronic
1010978836 6:82347260-82347282 TGGCATAGCCTATTGCTCCTAGG - Intergenic
1011177314 6:84578042-84578064 TGGTACAGCCTATTGCTCCTAGG - Intergenic
1012146275 6:95686987-95687009 TGTCACAGCCTTCTGTTCCCAGG - Intergenic
1012984441 6:105859837-105859859 TGGGACTGCCTACCTCTCTCTGG + Intergenic
1013180284 6:107711452-107711474 TGGTACAGCCTATTGCTTTTAGG - Intronic
1013415306 6:109919469-109919491 TGGTACAGCCTATGGCTCCCAGG + Intergenic
1014142357 6:117958642-117958664 TGGCATGGCCTACTGCTCCTAGG - Intronic
1014233655 6:118932215-118932237 TGGCATAGCCTGTTGCTCTTAGG - Intronic
1014259643 6:119201739-119201761 TGGCACAGCCTACTGTTTCTAGG + Intronic
1014748056 6:125223134-125223156 TGACACCTCCTACTGCTTTCTGG + Intronic
1015099490 6:129459142-129459164 TGGTATAGCCTACTGCTCCAAGG + Intronic
1015807079 6:137120615-137120637 TGGCACTGTCTACTGCTCAGAGG - Intergenic
1015816689 6:137218770-137218792 TGACACAGCCTACTGCTCTTAGG + Intronic
1016608225 6:145959434-145959456 TGGTACAGCCTGCTGCTCCTAGG - Intronic
1016733766 6:147453628-147453650 TGGCACAGCCTTATGGTCTCAGG + Intergenic
1017026156 6:150182876-150182898 TGGCACAGCCTATTACTCCTAGG + Intronic
1017126968 6:151074781-151074803 TGGTACAGCCTACTGCACCAGGG - Intronic
1017830334 6:158122161-158122183 TGGGACAGCCTATTGCTCCTAGG - Intronic
1017863038 6:158416958-158416980 TGGGACAGCCTACTACTCCTAGG - Intronic
1018283451 6:162212769-162212791 TGGTACAGCCTATTGCTCCTAGG + Intronic
1018439079 6:163792293-163792315 TGGTACAGCCTATTGCTCCTAGG - Intergenic
1019593048 7:1845169-1845191 TGGCACAGCCTGCTGGGCTCAGG + Intronic
1020020684 7:4865941-4865963 TGGCATAGCCTATTGCTCCTAGG - Intronic
1020766413 7:12327575-12327597 TGGTACAGCCTACTGCTCCTAGG + Intergenic
1021120717 7:16792298-16792320 TTGCCCAACCTAATGCTCTCAGG - Exonic
1021496657 7:21282504-21282526 TGGCACAGCCTATTGCTCCTAGG - Intergenic
1021546052 7:21814025-21814047 TGGCATAGCCTATTGCTCCTAGG + Intronic
1021555453 7:21913969-21913991 TGGCACTGCTGATTGCTCTCTGG + Intronic
1021859836 7:24895372-24895394 TGGTACAGCCTACTGCTCCCAGG - Intronic
1021920837 7:25483393-25483415 TGCCACAACCATCTGCTCTCTGG - Intergenic
1021929759 7:25568544-25568566 TGGCATAGCCTATTGCTCCTTGG - Intergenic
1023263043 7:38377524-38377546 TGGCACAGCCTACTACACAGAGG - Intergenic
1023527961 7:41124869-41124891 TAGTATAGCCTACTGCTCTTAGG - Intergenic
1023635084 7:42201663-42201685 TGGCATAGCCTGTTGCTCCCAGG + Intronic
1023809995 7:43904811-43904833 TGGTACAGCCTGTTGCTCTTAGG + Intronic
1024023319 7:45390444-45390466 TGTCACAGGCTCCTGCTCTGGGG - Intergenic
1024111512 7:46151969-46151991 TGGTATAGCCTATTGCTCTTAGG + Intergenic
1024665056 7:51537756-51537778 TGGTATAGCCTACTGCTCCTAGG - Intergenic
1024784933 7:52896496-52896518 TGGCACAGCCTATTGCTGCTTGG - Intergenic
1025280371 7:57622604-57622626 TGGCACAGCCTACTGCTCTCAGG - Intergenic
1025304362 7:57842897-57842919 TGGCACAGCCTACTGCTCTCAGG + Intergenic
1026688268 7:72531210-72531232 TGGTACAGCCTCCTGCTCCTAGG - Intergenic
1026723504 7:72853094-72853116 TGGTACAGCCTCCTGCTCCTAGG - Intergenic
1027501869 7:78961920-78961942 TGGTATAGCCTATTGCTCCCAGG + Intronic
1027771305 7:82409898-82409920 TGGTATAGCCTACTGCTCCTAGG + Intronic
1028868995 7:95745485-95745507 TGGTACAGCCTACTGCTCCTAGG + Intergenic
1031412074 7:121451402-121451424 TGGTACAGGCTATTGCTCCCAGG - Intergenic
1031674430 7:124591098-124591120 TGGTATAGCCTACTGCTCCTAGG + Intergenic
1032258702 7:130317290-130317312 TGGCATAGCCTATTGCTCCTAGG - Intronic
1032359920 7:131245697-131245719 TGGCATAGCCTATTGCTCCTAGG - Intronic
1032623217 7:133559641-133559663 AGGCACAGCCACCTGCTCTGTGG - Intronic
1032857515 7:135847479-135847501 TGGGACAGCCTACTGCTCCTAGG + Intergenic
1033491654 7:141849696-141849718 TGGTATAGCCTATTGCTCCCAGG + Intergenic
1033506669 7:142009818-142009840 TGGATCAGCATACCGCTCTCAGG - Intronic
1033616314 7:143017933-143017955 TGGTATAGCCTAGTGCTCTTAGG + Intergenic
1033927697 7:146484161-146484183 TGGTACAGCCTATTGCTCCCAGG - Intronic
1034856922 7:154558662-154558684 TGGCATAGCCTATTGCTCCAAGG - Intronic
1034940051 7:155224820-155224842 TGCCCCATCCTACTGCTCTGGGG + Intergenic
1035013857 7:155745878-155745900 TGGTACAGCCTGTTGCTCCCTGG + Intronic
1035099297 7:156383006-156383028 TGGCAGGGCCTGCTGCTCCCGGG + Intergenic
1035541835 8:446022-446044 TGGCACACCCTCCTGGTGTCTGG + Intronic
1035550048 8:515626-515648 TGGCACAACCCACTGATGTCAGG + Intronic
1035576044 8:706086-706108 TGGCACAGCCTGTTGCTCCCAGG - Intronic
1035595082 8:851207-851229 TGGCACAGCCCACAGCTCCCGGG - Intergenic
1035605327 8:926610-926632 TGGCACAGGGAGCTGCTCTCTGG + Intergenic
1035914685 8:3606334-3606356 TGGTACAGCCTAGTCCTCCCAGG + Intronic
1036088788 8:5642013-5642035 AGGCATTGCCTTCTGCTCTCTGG - Intergenic
1036116433 8:5965398-5965420 TGGCATAGCCTATTGCTCCCAGG - Intergenic
1036464193 8:8980987-8981009 TGGGACAGCCTATTGCTCTCAGG + Intergenic
1037180001 8:15993986-15994008 TGGTACGGCCTACTGCTCCTAGG + Intergenic
1037202407 8:16273198-16273220 TGGCATAGCCTAGTGCTCCTAGG + Intronic
1037791603 8:21948400-21948422 TGGTATAGCCTACTGCTCCTAGG - Intronic
1038063249 8:23935655-23935677 TGGTATAGCCTACTGCTCCTAGG - Intergenic
1039740490 8:40378535-40378557 TGGTGTAGCCTACTGCTCTTAGG + Intergenic
1040449490 8:47530081-47530103 TGGTATAGCCTACTGCTCCTAGG + Intronic
1040695893 8:49998035-49998057 TGGTATAGCCTATTGCTCTTAGG + Intronic
1040872532 8:52115568-52115590 TGGTACAGCCTACTGCTCTGAGG - Intronic
1041575894 8:59394897-59394919 TGGTACAGCTTATTGCTCCCAGG + Intergenic
1042296415 8:67222966-67222988 TGGCATAGCCTATTGCTCCTTGG - Intronic
1042991376 8:74644396-74644418 TGGTGTAGCCTATTGCTCTCAGG - Intronic
1044459600 8:92429265-92429287 AGGCGCAGCCTCCTGCTCTGTGG - Intergenic
1044626112 8:94235877-94235899 AGGGACAGGCTCCTGCTCTCTGG + Intergenic
1044944087 8:97374972-97374994 TGGCACTGCCTCCTGCTCTTGGG - Intergenic
1045270027 8:100653771-100653793 GGGCTCAGCCCTCTGCTCTCTGG - Intronic
1045480765 8:102590380-102590402 TGGCAGAGCCTACTGCTCCTAGG - Intergenic
1046139151 8:110067302-110067324 TGGTATAGCCTACTGCTCCTAGG - Intergenic
1047745080 8:127839020-127839042 TGGTACAGCCTACTGCTTCTAGG - Intergenic
1047974345 8:130114276-130114298 TGGTATAGCCTATTGCTCCCAGG + Intronic
1048085774 8:131177574-131177596 TGGTATAGCTTACTGCTCTGAGG + Intergenic
1049355826 8:142187558-142187580 TGGCACAGCCTGCTCCTCTGGGG + Intergenic
1049826179 8:144670316-144670338 GGGCACAGCCTCCTGGTCCCAGG - Intergenic
1050923522 9:11235005-11235027 TGCCACTGCCTACTGCTTCCTGG + Intergenic
1051243886 9:15089646-15089668 TGGCATAGCCTATTGCTCCTAGG - Intergenic
1051263945 9:15293205-15293227 TGGCATGGCCTATTGCTCCCAGG - Intronic
1052204296 9:25820141-25820163 TGGTATAGCCTATTGCTCTTGGG - Intergenic
1052636317 9:31109900-31109922 TGGTACAGCCTATTGCTCCTAGG - Intergenic
1052729631 9:32270030-32270052 TGGCATAGCCTATTGCTCCTAGG - Intergenic
1055183117 9:73414355-73414377 TGGCATAGCCTATTGCTCCCAGG + Intergenic
1056383039 9:86072824-86072846 TGCTACAGCCTAATGCTCCCAGG + Intronic
1058761676 9:108139783-108139805 TGGCATAGCCTATTGCTCCTAGG + Intergenic
1059086343 9:111306723-111306745 TGCTACAGCCTAATGCTTTCTGG - Intergenic
1059200301 9:112408601-112408623 TGGCATAGCCTATTGCTTCCAGG + Intronic
1059508467 9:114821087-114821109 TGGTAGAGCCTACTGCTCCTAGG + Intergenic
1059934493 9:119295424-119295446 TAGCATAGCCTATTGCTCTTAGG + Intronic
1060324441 9:122599142-122599164 TGGGACAGTCTTCTGGTCTCAGG - Intergenic
1060666341 9:125434207-125434229 TGGCCCAGGGTCCTGCTCTCTGG - Intergenic
1060776815 9:126380634-126380656 TGACACAGCCTCCTGCTCTAGGG - Intronic
1060904369 9:127291641-127291663 TGGTACTGCCTACTGCTCCTTGG + Intronic
1061500384 9:130998288-130998310 CGGCAGAGCCTCTTGCTCTCGGG + Intergenic
1061919258 9:133773207-133773229 CGGCAAAGCCTATTGCTCCCGGG + Intronic
1062080191 9:134619699-134619721 TGGCACAGGCCACTTCTCCCGGG - Intergenic
1062335980 9:136067891-136067913 TGGCATAGCCTAGTGCTCCTGGG + Intronic
1062497842 9:136839958-136839980 TGGCACAGCATCCTGGACTCAGG - Intronic
1203631746 Un_KI270750v1:77392-77414 TGGCACAGCCTACCGCTCTCAGG - Intergenic
1186456710 X:9715432-9715454 TGGTACAGCCTATTGCTCCCAGG + Intronic
1186508107 X:10110169-10110191 GGGCACTGCCTTCTGCTCCCTGG + Intronic
1186621361 X:11243877-11243899 TGGTAGAGCCTACTGCTCCTAGG - Intronic
1187432430 X:19237281-19237303 TGACACAGCCTCCAACTCTCTGG - Intergenic
1188509053 X:30913807-30913829 TGGTATAGCCTATTGCTCACAGG + Intronic
1188772525 X:34171077-34171099 TGGTATAGCCTATTGCTCACAGG - Intergenic
1190402278 X:50049315-50049337 TGGTATAGCCTATTGCTCTTAGG - Intronic
1191762873 X:64663547-64663569 GGGCACAGCTTTCTGTTCTCTGG + Intergenic
1191963336 X:66727792-66727814 TGGTATAGCCTATTGCTCCCAGG + Intergenic
1192569936 X:72194974-72194996 TGGCATAGCCTATTGCTCCTAGG - Intronic
1193015903 X:76733578-76733600 CAGCACAGCCTAGTGCTCTAAGG - Intergenic
1193969864 X:88038229-88038251 TGGTACAGCCTATTGCTCCCAGG - Intergenic
1194431519 X:93812943-93812965 TGGCACTTCCTATTGCTTTCTGG - Intergenic
1194904945 X:99563589-99563611 TGGTACAGCCTATTGCTCCCAGG + Intergenic
1195296336 X:103481794-103481816 TGGTACAGCCTGTTGCTCCCAGG + Intergenic
1195404743 X:104500555-104500577 TGGCACAGTGTAATGGTCTCTGG + Intergenic
1195424313 X:104711181-104711203 TGGTACAGCCTATTGCTCCTAGG - Intronic
1195892849 X:109714728-109714750 TGGTACAGCCTATTGCTCTTAGG - Intronic
1196041398 X:111208607-111208629 TGGTACAGCCTATTGCTCCTAGG - Intronic
1196828538 X:119758974-119758996 AGGCACAGCCTGCTGCTGCCCGG - Exonic
1197230793 X:124001701-124001723 TGGCATAGCTTACTGCTCCTAGG - Intronic
1197419490 X:126221023-126221045 TGGTATAGCCTATTGCTCTTAGG + Intergenic
1201950979 Y:19563538-19563560 TGATATAGCCTATTGCTCTCAGG + Intergenic